Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412173881:

Variant ID: vg0412173881 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12173881
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

CACCCAAGCACAATATAGCTTCGCCCCTGAGAATACATGTTTCACTGGTGGAGAAAGCCTTTTTACTCCCTGTTGGTAACCCCCCTATAGTCCCGGTTTT[C/T]
CAACTGGGAGTATGAATCCGAGACTAAAGATCGTTATCTTTAGTCCCGGTTCAAATACCCGGGACTAAAGAGATAGTAGCGCTTTTTTTTCTTTTGCCAG

Reverse complement sequence

CTGGCAAAAGAAAAAAAAGCGCTACTATCTCTTTAGTCCCGGGTATTTGAACCGGGACTAAAGATAACGATCTTTAGTCTCGGATTCATACTCCCAGTTG[G/A]
AAAACCGGGACTATAGGGGGGTTACCAACAGGGAGTAAAAAGGCTTTCTCCACCAGTGAAACATGTATTCTCAGGGGCGAAGCTATATTGTGCTTGGGTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.40%	41.60%	4.51%	1.48%	NA
All Indica	2759	83.10%	6.80%	7.54%	2.54%	NA
All Japonica	1512	1.10%	98.90%	0.07%	0.00%	NA
Aus	269	47.60%	52.40%	0.00%	0.00%	NA
Indica I	595	88.40%	0.80%	8.24%	2.52%	NA
Indica II	465	92.70%	4.10%	2.37%	0.86%	NA
Indica III	913	73.50%	12.20%	10.73%	3.61%	NA
Indica Intermediate	786	84.60%	6.70%	6.36%	2.29%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	1.20%	98.60%	0.20%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	96.90%	1.04%	0.00%	NA
Intermediate	90	43.30%	53.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412173881	C -> DEL	N	N	silent_mutation	Average:32.84; most accessible tissue: Zhenshan97 young leaf, score: 42.553	N	N	N	N
vg0412173881	C -> T	LOC_Os04g21530.1	upstream_gene_variant ; 1695.0bp to feature; MODIFIER	silent_mutation	Average:32.84; most accessible tissue: Zhenshan97 young leaf, score: 42.553	N	N	N	N
vg0412173881	C -> T	LOC_Os04g21510.1	downstream_gene_variant ; 4370.0bp to feature; MODIFIER	silent_mutation	Average:32.84; most accessible tissue: Zhenshan97 young leaf, score: 42.553	N	N	N	N
vg0412173881	C -> T	LOC_Os04g21520.1	downstream_gene_variant ; 893.0bp to feature; MODIFIER	silent_mutation	Average:32.84; most accessible tissue: Zhenshan97 young leaf, score: 42.553	N	N	N	N
vg0412173881	C -> T	LOC_Os04g21520-LOC_Os04g21530	intergenic_region ; MODIFIER	silent_mutation	Average:32.84; most accessible tissue: Zhenshan97 young leaf, score: 42.553	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412173881	NA	5.73E-15	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881	NA	2.01E-39	mr1534	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881	NA	8.56E-18	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881	NA	6.77E-16	mr1700	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881	NA	1.57E-55	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881	NA	3.24E-16	mr1040_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881	NA	2.79E-58	mr1067_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881	6.09E-07	NA	mr1100_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881	NA	4.00E-55	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881	5.55E-07	NA	mr1619_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881	NA	1.86E-49	mr1721_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881	NA	2.74E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881	NA	3.78E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881	NA	8.86E-09	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881	NA	1.36E-32	mr1913_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881	NA	4.14E-26	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881	NA	2.36E-14	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251