\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412173881:

Variant ID: vg0412173881 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12173881
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CACCCAAGCACAATATAGCTTCGCCCCTGAGAATACATGTTTCACTGGTGGAGAAAGCCTTTTTACTCCCTGTTGGTAACCCCCCTATAGTCCCGGTTTT[C/T]
CAACTGGGAGTATGAATCCGAGACTAAAGATCGTTATCTTTAGTCCCGGTTCAAATACCCGGGACTAAAGAGATAGTAGCGCTTTTTTTTCTTTTGCCAG

Reverse complement sequence

CTGGCAAAAGAAAAAAAAGCGCTACTATCTCTTTAGTCCCGGGTATTTGAACCGGGACTAAAGATAACGATCTTTAGTCTCGGATTCATACTCCCAGTTG[G/A]
AAAACCGGGACTATAGGGGGGTTACCAACAGGGAGTAAAAAGGCTTTCTCCACCAGTGAAACATGTATTCTCAGGGGCGAAGCTATATTGTGCTTGGGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.40% 41.60% 4.51% 1.48% NA
All Indica  2759 83.10% 6.80% 7.54% 2.54% NA
All Japonica  1512 1.10% 98.90% 0.07% 0.00% NA
Aus  269 47.60% 52.40% 0.00% 0.00% NA
Indica I  595 88.40% 0.80% 8.24% 2.52% NA
Indica II  465 92.70% 4.10% 2.37% 0.86% NA
Indica III  913 73.50% 12.20% 10.73% 3.61% NA
Indica Intermediate  786 84.60% 6.70% 6.36% 2.29% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.60% 0.20% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 96.90% 1.04% 0.00% NA
Intermediate  90 43.30% 53.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412173881 C -> DEL N N silent_mutation Average:32.84; most accessible tissue: Zhenshan97 young leaf, score: 42.553 N N N N
vg0412173881 C -> T LOC_Os04g21530.1 upstream_gene_variant ; 1695.0bp to feature; MODIFIER silent_mutation Average:32.84; most accessible tissue: Zhenshan97 young leaf, score: 42.553 N N N N
vg0412173881 C -> T LOC_Os04g21510.1 downstream_gene_variant ; 4370.0bp to feature; MODIFIER silent_mutation Average:32.84; most accessible tissue: Zhenshan97 young leaf, score: 42.553 N N N N
vg0412173881 C -> T LOC_Os04g21520.1 downstream_gene_variant ; 893.0bp to feature; MODIFIER silent_mutation Average:32.84; most accessible tissue: Zhenshan97 young leaf, score: 42.553 N N N N
vg0412173881 C -> T LOC_Os04g21520-LOC_Os04g21530 intergenic_region ; MODIFIER silent_mutation Average:32.84; most accessible tissue: Zhenshan97 young leaf, score: 42.553 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412173881 NA 5.73E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881 NA 2.01E-39 mr1534 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881 NA 8.56E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881 NA 6.77E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881 NA 1.57E-55 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881 NA 3.24E-16 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881 NA 2.79E-58 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881 6.09E-07 NA mr1100_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881 NA 4.00E-55 mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881 5.55E-07 NA mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881 NA 1.86E-49 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881 NA 2.74E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881 NA 3.78E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881 NA 8.86E-09 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881 NA 1.36E-32 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881 NA 4.14E-26 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412173881 NA 2.36E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251