Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412144864:

Variant ID: vg0412144864 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12144864
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

TATGCTGACTGTAAGAATGAAATAGCCTGGGACTTTGACGATGCTTTTAAAGTGAAGGAGTACTTAGTAACTCGTGGATTTATGGGCAAGTACGAAATAT[A/G]
GACACGTCATGGCGAAGAACAAGTGGACAGGCCTGAAAATGTAGTTTTTTTTTTTGACTGAAAGTACTGCCAGGTCTTTGCCCAACAGTGTGATTTTCAT

Reverse complement sequence

ATGAAAATCACACTGTTGGGCAAAGACCTGGCAGTACTTTCAGTCAAAAAAAAAAACTACATTTTCAGGCCTGTCCACTTGTTCTTCGCCATGACGTGTC[T/C]
ATATTTCGTACTTGCCCATAAATCCACGAGTTACTAAGTACTCCTTCACTTTAAAAGCATCGTCAAAGTCCCAGGCTATTTCATTCTTACAGTCAGCATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.00%	4.90%	20.23%	32.82%	NA
All Indica	2759	7.40%	8.00%	30.45%	54.11%	NA
All Japonica	1512	99.10%	0.10%	0.53%	0.33%	NA
Aus	269	52.40%	2.60%	33.46%	11.52%	NA
Indica I	595	1.00%	3.00%	23.03%	72.94%	NA
Indica II	465	4.50%	23.00%	31.18%	41.29%	NA
Indica III	913	12.80%	5.10%	31.33%	50.71%	NA
Indica Intermediate	786	7.80%	6.20%	34.61%	51.40%	NA
Temperate Japonica	767	99.50%	0.00%	0.13%	0.39%	NA
Tropical Japonica	504	99.00%	0.00%	0.60%	0.40%	NA
Japonica Intermediate	241	97.90%	0.40%	1.66%	0.00%	NA
VI/Aromatic	96	97.90%	0.00%	2.08%	0.00%	NA
Intermediate	90	54.40%	3.30%	17.78%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412144864	A -> DEL	N	N	silent_mutation	Average:15.514; most accessible tissue: Zhenshan97 young leaf, score: 18.918	N	N	N	N
vg0412144864	A -> G	LOC_Os04g21460.1	downstream_gene_variant ; 4812.0bp to feature; MODIFIER	silent_mutation	Average:15.514; most accessible tissue: Zhenshan97 young leaf, score: 18.918	N	N	N	N
vg0412144864	A -> G	LOC_Os04g21470.1	downstream_gene_variant ; 1495.0bp to feature; MODIFIER	silent_mutation	Average:15.514; most accessible tissue: Zhenshan97 young leaf, score: 18.918	N	N	N	N
vg0412144864	A -> G	LOC_Os04g21480.1	downstream_gene_variant ; 1425.0bp to feature; MODIFIER	silent_mutation	Average:15.514; most accessible tissue: Zhenshan97 young leaf, score: 18.918	N	N	N	N
vg0412144864	A -> G	LOC_Os04g21490.1	downstream_gene_variant ; 4775.0bp to feature; MODIFIER	silent_mutation	Average:15.514; most accessible tissue: Zhenshan97 young leaf, score: 18.918	N	N	N	N
vg0412144864	A -> G	LOC_Os04g21470-LOC_Os04g21480	intergenic_region ; MODIFIER	silent_mutation	Average:15.514; most accessible tissue: Zhenshan97 young leaf, score: 18.918	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412144864	9.27E-06	NA	mr1071	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	5.72E-06	NA	mr1080	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	NA	3.38E-15	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	NA	3.24E-39	mr1534	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	NA	5.92E-56	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	NA	3.49E-16	mr1040_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	NA	2.48E-59	mr1067_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	7.83E-07	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	NA	4.79E-62	mr1078_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	3.89E-07	NA	mr1080_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	NA	6.47E-70	mr1087_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	4.31E-06	NA	mr1100_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	4.86E-06	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	NA	1.97E-56	mr1211_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	2.25E-07	NA	mr1613_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	7.12E-07	NA	mr1619_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	NA	1.88E-48	mr1721_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	NA	1.02E-06	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	NA	6.71E-08	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	NA	3.44E-08	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	NA	1.39E-32	mr1913_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	NA	1.28E-24	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144864	NA	8.55E-15	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251