\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412144728:

Variant ID: vg0412144728 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12144728
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TAGAGATATGGAAAGTCAGGAATGGATGTATCATTGGCCGAGGTTTTTGTCTCCATATAGAAACGAAGTGTCTAAATTTATTGGTATTGCCAATGCACAC[G/A]
CTGAGAAGAACAATATGAGGAAGATAATTTATCCATATGCTGACTGTAAGAATGAAATAGCCTGGGACTTTGACGATGCTTTTAAAGTGAAGGAGTACTT

Reverse complement sequence

AAGTACTCCTTCACTTTAAAAGCATCGTCAAAGTCCCAGGCTATTTCATTCTTACAGTCAGCATATGGATAAATTATCTTCCTCATATTGTTCTTCTCAG[C/T]
GTGTGCATTGGCAATACCAATAAATTTAGACACTTCGTTTCTATATGGAGACAAAAACCTCGGCCAATGATACATCCATTCCTGACTTTCCATATCTCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 42.00% 0.06% 0.00% NA
All Indica  2759 92.70% 7.20% 0.11% 0.00% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 47.60% 52.40% 0.00% 0.00% NA
Indica I  595 99.30% 0.50% 0.17% 0.00% NA
Indica II  465 95.50% 4.30% 0.22% 0.00% NA
Indica III  913 87.40% 12.60% 0.00% 0.00% NA
Indica Intermediate  786 92.20% 7.60% 0.13% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 42.20% 57.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412144728 G -> A LOC_Os04g21460.1 downstream_gene_variant ; 4676.0bp to feature; MODIFIER silent_mutation Average:13.89; most accessible tissue: Callus, score: 26.883 N N N N
vg0412144728 G -> A LOC_Os04g21470.1 downstream_gene_variant ; 1359.0bp to feature; MODIFIER silent_mutation Average:13.89; most accessible tissue: Callus, score: 26.883 N N N N
vg0412144728 G -> A LOC_Os04g21480.1 downstream_gene_variant ; 1561.0bp to feature; MODIFIER silent_mutation Average:13.89; most accessible tissue: Callus, score: 26.883 N N N N
vg0412144728 G -> A LOC_Os04g21490.1 downstream_gene_variant ; 4911.0bp to feature; MODIFIER silent_mutation Average:13.89; most accessible tissue: Callus, score: 26.883 N N N N
vg0412144728 G -> A LOC_Os04g21470-LOC_Os04g21480 intergenic_region ; MODIFIER silent_mutation Average:13.89; most accessible tissue: Callus, score: 26.883 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412144728 3.94E-06 1.05E-07 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144728 9.76E-08 7.47E-09 mr1080 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144728 3.29E-07 3.23E-08 mr1140 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144728 3.48E-06 2.15E-07 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144728 1.85E-06 3.08E-07 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144728 7.45E-06 2.68E-07 mr1618 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144728 NA 1.83E-29 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144728 NA 1.10E-53 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144728 2.05E-08 3.78E-10 mr1071_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144728 1.02E-08 1.58E-09 mr1080_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144728 1.81E-09 1.81E-10 mr1203_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144728 2.29E-08 8.83E-10 mr1613_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144728 1.36E-06 7.84E-07 mr1619_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412144728 NA 9.24E-32 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251