\
| Variant ID: vg0412137273 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12137273 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 232. )
ACATTATTAGCATAGTTCTCTCTTACAATGTTCCCTTGGCATTAAATAAATACGATACCTTGGAATACTCCCAGGTGAAATGCTACAATGGTATATCCGT[G/A]
CGCTTGCCGATTCCTTCTATAACCATATATATACTAGGACCATTTCTGGCGTCATTGCTGGGAATTCATATTTCTAGTAATGTCGTTAAGAAATACCAAC
GTTGGTATTTCTTAACGACATTACTAGAAATATGAATTCCCAGCAATGACGCCAGAAATGGTCCTAGTATATATATGGTTATAGAAGGAATCGGCAAGCG[C/T]
ACGGATATACCATTGTAGCATTTCACCTGGGAGTATTCCAAGGTATCGTATTTATTTAATGCCAAGGGAACATTGTAAGAGAGAACTATGCTAATAATGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.90% | 43.00% | 0.23% | 0.91% | NA |
| All Indica | 2759 | 89.10% | 9.40% | 0.14% | 1.38% | NA |
| All Japonica | 1512 | 0.90% | 98.80% | 0.26% | 0.07% | NA |
| Aus | 269 | 48.30% | 50.90% | 0.00% | 0.74% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 75.50% | 23.70% | 0.22% | 0.65% | NA |
| Indica III | 913 | 87.60% | 9.50% | 0.11% | 2.74% | NA |
| Indica Intermediate | 786 | 90.80% | 7.60% | 0.25% | 1.27% | NA |
| Temperate Japonica | 767 | 0.40% | 99.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 98.40% | 0.40% | 0.20% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 95.80% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 42.20% | 53.30% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412137273 | G -> DEL | N | N | silent_mutation | Average:40.981; most accessible tissue: Zhenshan97 young leaf, score: 55.899 | N | N | N | N |
| vg0412137273 | G -> A | LOC_Os04g21460.1 | upstream_gene_variant ; 1825.0bp to feature; MODIFIER | silent_mutation | Average:40.981; most accessible tissue: Zhenshan97 young leaf, score: 55.899 | N | N | N | N |
| vg0412137273 | G -> A | LOC_Os04g21450-LOC_Os04g21460 | intergenic_region ; MODIFIER | silent_mutation | Average:40.981; most accessible tissue: Zhenshan97 young leaf, score: 55.899 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412137273 | NA | 1.11E-06 | mr1071 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412137273 | NA | 8.09E-06 | mr1613 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412137273 | NA | 2.34E-16 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412137273 | 6.56E-09 | NA | mr1071_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412137273 | 6.16E-09 | NA | mr1080_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412137273 | 7.52E-07 | NA | mr1100_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412137273 | 1.53E-08 | NA | mr1203_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412137273 | NA | 1.19E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412137273 | NA | 3.45E-20 | mr1362_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412137273 | 4.04E-09 | 7.62E-09 | mr1613_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412137273 | NA | 9.36E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |