\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412137273:

Variant ID: vg0412137273 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12137273
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


ACATTATTAGCATAGTTCTCTCTTACAATGTTCCCTTGGCATTAAATAAATACGATACCTTGGAATACTCCCAGGTGAAATGCTACAATGGTATATCCGT[G/A]
CGCTTGCCGATTCCTTCTATAACCATATATATACTAGGACCATTTCTGGCGTCATTGCTGGGAATTCATATTTCTAGTAATGTCGTTAAGAAATACCAAC

Reverse complement sequence

GTTGGTATTTCTTAACGACATTACTAGAAATATGAATTCCCAGCAATGACGCCAGAAATGGTCCTAGTATATATATGGTTATAGAAGGAATCGGCAAGCG[C/T]
ACGGATATACCATTGTAGCATTTCACCTGGGAGTATTCCAAGGTATCGTATTTATTTAATGCCAAGGGAACATTGTAAGAGAGAACTATGCTAATAATGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 43.00% 0.23% 0.91% NA
All Indica  2759 89.10% 9.40% 0.14% 1.38% NA
All Japonica  1512 0.90% 98.80% 0.26% 0.07% NA
Aus  269 48.30% 50.90% 0.00% 0.74% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 75.50% 23.70% 0.22% 0.65% NA
Indica III  913 87.60% 9.50% 0.11% 2.74% NA
Indica Intermediate  786 90.80% 7.60% 0.25% 1.27% NA
Temperate Japonica  767 0.40% 99.50% 0.13% 0.00% NA
Tropical Japonica  504 1.00% 98.40% 0.40% 0.20% NA
Japonica Intermediate  241 2.10% 97.50% 0.41% 0.00% NA
VI/Aromatic  96 3.10% 95.80% 0.00% 1.04% NA
Intermediate  90 42.20% 53.30% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412137273 G -> DEL N N silent_mutation Average:40.981; most accessible tissue: Zhenshan97 young leaf, score: 55.899 N N N N
vg0412137273 G -> A LOC_Os04g21460.1 upstream_gene_variant ; 1825.0bp to feature; MODIFIER silent_mutation Average:40.981; most accessible tissue: Zhenshan97 young leaf, score: 55.899 N N N N
vg0412137273 G -> A LOC_Os04g21450-LOC_Os04g21460 intergenic_region ; MODIFIER silent_mutation Average:40.981; most accessible tissue: Zhenshan97 young leaf, score: 55.899 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412137273 NA 1.11E-06 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412137273 NA 8.09E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412137273 NA 2.34E-16 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412137273 6.56E-09 NA mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412137273 6.16E-09 NA mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412137273 7.52E-07 NA mr1100_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412137273 1.53E-08 NA mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412137273 NA 1.19E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412137273 NA 3.45E-20 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412137273 4.04E-09 7.62E-09 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412137273 NA 9.36E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251