\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412124797:

Variant ID: vg0412124797 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12124797
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.54, G: 0.46, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


AACCTCTAACGATGAAGCCACTCGCTCAACCATCCACTTCTGCTAGCTCGATTGATGAAAAGGTTCCTGAGCAGCCGTCCGTCGAGAATGAAGAGATTCA[A/G,T]
ACTCCGGATCGAGAGAGCTCCACTACTCATCGCTCTCCTCCAGTTGTCCACTAGACAGCGCTAGGGTCACCACCTAGCTGCGTCGCCACCACCGTCGAGC

Reverse complement sequence

GCTCGACGGTGGTGGCGACGCAGCTAGGTGGTGACCCTAGCGCTGTCTAGTGGACAACTGGAGGAGAGCGATGAGTAGTGGAGCTCTCTCGATCCGGAGT[T/C,A]
TGAATCTCTTCATTCTCGACGGACGGCTGCTCAGGAACCTTTTCATCAATCGAGCTAGCAGAAGTGGATGGTTGAGCGAGTGGCTTCATCGTTAGAGGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 15.70% 2.58% 14.79% NA
All Indica  2759 99.10% 0.50% 0.11% 0.25% NA
All Japonica  1512 5.20% 47.20% 6.75% 40.81% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 98.10% 0.90% 0.22% 0.86% NA
Indica III  913 99.60% 0.30% 0.11% 0.00% NA
Indica Intermediate  786 98.70% 0.90% 0.13% 0.25% NA
Temperate Japonica  767 0.70% 80.30% 0.26% 18.77% NA
Tropical Japonica  504 10.90% 3.40% 17.66% 68.06% NA
Japonica Intermediate  241 7.90% 33.60% 4.56% 53.94% NA
VI/Aromatic  96 26.00% 0.00% 12.50% 61.46% NA
Intermediate  90 58.90% 17.80% 5.56% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412124797 A -> DEL N N silent_mutation Average:66.215; most accessible tissue: Minghui63 young leaf, score: 80.883 N N N N
vg0412124797 A -> G LOC_Os04g21450.1 downstream_gene_variant ; 1879.0bp to feature; MODIFIER silent_mutation Average:66.215; most accessible tissue: Minghui63 young leaf, score: 80.883 N N N N
vg0412124797 A -> G LOC_Os04g21430-LOC_Os04g21450 intergenic_region ; MODIFIER silent_mutation Average:66.215; most accessible tissue: Minghui63 young leaf, score: 80.883 N N N N
vg0412124797 A -> T LOC_Os04g21450.1 downstream_gene_variant ; 1879.0bp to feature; MODIFIER N Average:66.215; most accessible tissue: Minghui63 young leaf, score: 80.883 N N N N
vg0412124797 A -> T LOC_Os04g21430-LOC_Os04g21450 intergenic_region ; MODIFIER N Average:66.215; most accessible tissue: Minghui63 young leaf, score: 80.883 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412124797 NA 7.69E-34 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412124797 6.97E-06 NA mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412124797 7.21E-07 NA mr1410 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412124797 NA 5.66E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412124797 NA 6.14E-21 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412124797 NA 4.88E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412124797 NA 1.85E-11 mr1520_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251