Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412124797:

Variant ID: vg0412124797 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12124797
Reference Allele: A	Alternative Allele: G,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.54, G: 0.46, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

AACCTCTAACGATGAAGCCACTCGCTCAACCATCCACTTCTGCTAGCTCGATTGATGAAAAGGTTCCTGAGCAGCCGTCCGTCGAGAATGAAGAGATTCA[A/G,T]
ACTCCGGATCGAGAGAGCTCCACTACTCATCGCTCTCCTCCAGTTGTCCACTAGACAGCGCTAGGGTCACCACCTAGCTGCGTCGCCACCACCGTCGAGC

Reverse complement sequence

GCTCGACGGTGGTGGCGACGCAGCTAGGTGGTGACCCTAGCGCTGTCTAGTGGACAACTGGAGGAGAGCGATGAGTAGTGGAGCTCTCTCGATCCGGAGT[T/C,A]
TGAATCTCTTCATTCTCGACGGACGGCTGCTCAGGAACCTTTTCATCAATCGAGCTAGCAGAAGTGGATGGTTGAGCGAGTGGCTTCATCGTTAGAGGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.90%	15.70%	2.58%	14.79%	NA
All Indica	2759	99.10%	0.50%	0.11%	0.25%	NA
All Japonica	1512	5.20%	47.20%	6.75%	40.81%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.00%	0.17%	NA
Indica II	465	98.10%	0.90%	0.22%	0.86%	NA
Indica III	913	99.60%	0.30%	0.11%	0.00%	NA
Indica Intermediate	786	98.70%	0.90%	0.13%	0.25%	NA
Temperate Japonica	767	0.70%	80.30%	0.26%	18.77%	NA
Tropical Japonica	504	10.90%	3.40%	17.66%	68.06%	NA
Japonica Intermediate	241	7.90%	33.60%	4.56%	53.94%	NA
VI/Aromatic	96	26.00%	0.00%	12.50%	61.46%	NA
Intermediate	90	58.90%	17.80%	5.56%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412124797	A -> DEL	N	N	silent_mutation	Average:66.215; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N
vg0412124797	A -> G	LOC_Os04g21450.1	downstream_gene_variant ; 1879.0bp to feature; MODIFIER	silent_mutation	Average:66.215; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N
vg0412124797	A -> G	LOC_Os04g21430-LOC_Os04g21450	intergenic_region ; MODIFIER	silent_mutation	Average:66.215; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N
vg0412124797	A -> T	LOC_Os04g21450.1	downstream_gene_variant ; 1879.0bp to feature; MODIFIER	N	Average:66.215; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N
vg0412124797	A -> T	LOC_Os04g21430-LOC_Os04g21450	intergenic_region ; MODIFIER	N	Average:66.215; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412124797	NA	7.69E-34	mr1350	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412124797	6.97E-06	NA	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412124797	7.21E-07	NA	mr1410	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412124797	NA	5.66E-14	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412124797	NA	6.14E-21	mr1689	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412124797	NA	4.88E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412124797	NA	1.85E-11	mr1520_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251