\
| Variant ID: vg0412100387 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12100387 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CCTGAGAACAATTCTCAGGTTGCGATACCAATCCATGAAGTTTGTTCCAGTCAACTTCTCTTTCTCAAGAATAGACCGCAAGTTAAAATTGGATGGTGCA[T/G]
GAGCTGCCATAATCTACAATAGAAATATATGTATGCAAAATCAGCACCATGTTTACATTTAACCTTTCATCAAACAATTTAACAAAAGATACTCCCATTA
TAATGGGAGTATCTTTTGTTAAATTGTTTGATGAAAGGTTAAATGTAAACATGGTGCTGATTTTGCATACATATATTTCTATTGTAGATTATGGCAGCTC[A/C]
TGCACCATCCAATTTTAACTTGCGGTCTATTCTTGAGAAAGAGAAGTTGACTGGAACAAACTTCATGGATTGGTATCGCAACCTGAGAATTGTTCTCAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.60% | 1.70% | 4.13% | 57.60% | NA |
| All Indica | 2759 | 3.30% | 2.60% | 5.51% | 88.58% | NA |
| All Japonica | 1512 | 98.90% | 0.20% | 0.20% | 0.73% | NA |
| Aus | 269 | 5.20% | 0.00% | 11.90% | 82.90% | NA |
| Indica I | 595 | 1.70% | 0.00% | 1.34% | 96.97% | NA |
| Indica II | 465 | 3.70% | 7.10% | 16.13% | 73.12% | NA |
| Indica III | 913 | 3.30% | 2.70% | 3.61% | 90.36% | NA |
| Indica Intermediate | 786 | 4.20% | 1.90% | 4.58% | 89.31% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 98.80% | 0.00% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 96.70% | 1.20% | 1.24% | 0.83% | NA |
| VI/Aromatic | 96 | 86.50% | 0.00% | 3.12% | 10.42% | NA |
| Intermediate | 90 | 54.40% | 2.20% | 5.56% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412100387 | T -> DEL | LOC_Os04g21410.1 | N | frameshift_variant | Average:7.66; most accessible tissue: Callus, score: 24.523 | N | N | N | N |
| vg0412100387 | T -> G | LOC_Os04g21410.1 | missense_variant ; p.His81Pro; MODERATE | nonsynonymous_codon ; H81P | Average:7.66; most accessible tissue: Callus, score: 24.523 | unknown | unknown | TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412100387 | 2.86E-07 | 4.97E-10 | mr1071 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412100387 | NA | 2.44E-08 | mr1080 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412100387 | 1.95E-07 | 1.42E-09 | mr1140 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412100387 | 3.78E-08 | 2.42E-11 | mr1203 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412100387 | NA | 2.69E-07 | mr1395 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412100387 | NA | 3.93E-07 | mr1613 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412100387 | 4.42E-07 | 1.68E-09 | mr1618 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412100387 | 7.28E-07 | 1.02E-10 | mr1071_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412100387 | 9.80E-07 | 6.45E-11 | mr1080_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412100387 | 6.34E-07 | 2.83E-10 | mr1203_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412100387 | NA | 1.22E-46 | mr1458_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412100387 | 5.75E-09 | 1.56E-12 | mr1613_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412100387 | NA | 1.02E-06 | mr1619_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412100387 | NA | 6.11E-31 | mr1913_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |