Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412080354:

Variant ID: vg0412080354 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 12080354
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTGGGAGATCTGCTTAACTCCAGTGCAGGTCCAAAATATTGATGAGATGTAGGCATTCCAATCAGTTTTATCCTGCAACTGACAAGACGTATGAAATGAA[G/A]
ATCAGAGAACCACTCGGCCAATAAGTTGATAGCAATGCTAGCCAATGCCAATACCAGCTGATGTCGATATGGTTTTGAGCAACCGGCTATATGTCCAATC

Reverse complement sequence

GATTGGACATATAGCCGGTTGCTCAAAACCATATCGACATCAGCTGGTATTGGCATTGGCTAGCATTGCTATCAACTTATTGGCCGAGTGGTTCTCTGAT[C/T]
TTCATTTCATACGTCTTGTCAGTTGCAGGATAAAACTGATTGGAATGCCTACATCTCATCAATATTTTGGACCTGCACTGGAGTTAAGCAGATCTCCCAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.00%	13.40%	1.65%	22.89%	NA
All Indica	2759	64.70%	0.50%	1.16%	33.67%	NA
All Japonica	1512	57.00%	39.60%	2.78%	0.60%	NA
Aus	269	54.60%	0.00%	0.74%	44.61%	NA
Indica I	595	78.20%	0.00%	1.01%	20.84%	NA
Indica II	465	54.00%	1.30%	1.29%	43.44%	NA
Indica III	913	68.60%	0.20%	0.55%	30.67%	NA
Indica Intermediate	786	56.40%	0.60%	1.91%	41.09%	NA
Temperate Japonica	767	92.40%	3.10%	4.43%	0.00%	NA
Tropical Japonica	504	9.30%	89.70%	0.00%	0.99%	NA
Japonica Intermediate	241	44.00%	51.00%	3.32%	1.66%	NA
VI/Aromatic	96	91.70%	6.20%	0.00%	2.08%	NA
Intermediate	90	54.40%	18.90%	2.22%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0412080354	G -> DEL	N	N	silent_mutation	Average:19.911; most accessible tissue: Callus, score: 41.793	N	N	N	N
vg0412080354	G -> A	LOC_Os04g21380.1	upstream_gene_variant ; 4428.0bp to feature; MODIFIER	silent_mutation	Average:19.911; most accessible tissue: Callus, score: 41.793	N	N	N	N
vg0412080354	G -> A	LOC_Os04g21370.1	downstream_gene_variant ; 855.0bp to feature; MODIFIER	silent_mutation	Average:19.911; most accessible tissue: Callus, score: 41.793	N	N	N	N
vg0412080354	G -> A	LOC_Os04g21370-LOC_Os04g21380	intergenic_region ; MODIFIER	silent_mutation	Average:19.911; most accessible tissue: Callus, score: 41.793	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0412080354	5.71E-06	NA	mr1071	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	2.98E-07	NA	mr1140	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	NA	3.51E-10	mr1178	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	3.66E-07	NA	mr1203	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	NA	3.84E-23	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	NA	2.40E-06	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	4.00E-06	NA	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	7.36E-07	NA	mr1549	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	NA	6.12E-09	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	NA	3.27E-07	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	NA	5.99E-10	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	8.74E-08	NA	mr1618	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	NA	7.89E-09	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	4.62E-06	NA	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	NA	6.00E-13	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	NA	2.45E-12	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	NA	7.89E-06	mr1905	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	NA	2.16E-07	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	NA	1.16E-07	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	NA	7.02E-10	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	NA	4.16E-20	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	8.54E-06	NA	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	NA	4.77E-10	mr1580_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	NA	2.08E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	NA	4.46E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	NA	1.77E-14	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354	NA	1.77E-10	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251