\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0412080354:

Variant ID: vg0412080354 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 12080354
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGGGAGATCTGCTTAACTCCAGTGCAGGTCCAAAATATTGATGAGATGTAGGCATTCCAATCAGTTTTATCCTGCAACTGACAAGACGTATGAAATGAA[G/A]
ATCAGAGAACCACTCGGCCAATAAGTTGATAGCAATGCTAGCCAATGCCAATACCAGCTGATGTCGATATGGTTTTGAGCAACCGGCTATATGTCCAATC

Reverse complement sequence

GATTGGACATATAGCCGGTTGCTCAAAACCATATCGACATCAGCTGGTATTGGCATTGGCTAGCATTGCTATCAACTTATTGGCCGAGTGGTTCTCTGAT[C/T]
TTCATTTCATACGTCTTGTCAGTTGCAGGATAAAACTGATTGGAATGCCTACATCTCATCAATATTTTGGACCTGCACTGGAGTTAAGCAGATCTCCCAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.00% 13.40% 1.65% 22.89% NA
All Indica  2759 64.70% 0.50% 1.16% 33.67% NA
All Japonica  1512 57.00% 39.60% 2.78% 0.60% NA
Aus  269 54.60% 0.00% 0.74% 44.61% NA
Indica I  595 78.20% 0.00% 1.01% 20.84% NA
Indica II  465 54.00% 1.30% 1.29% 43.44% NA
Indica III  913 68.60% 0.20% 0.55% 30.67% NA
Indica Intermediate  786 56.40% 0.60% 1.91% 41.09% NA
Temperate Japonica  767 92.40% 3.10% 4.43% 0.00% NA
Tropical Japonica  504 9.30% 89.70% 0.00% 0.99% NA
Japonica Intermediate  241 44.00% 51.00% 3.32% 1.66% NA
VI/Aromatic  96 91.70% 6.20% 0.00% 2.08% NA
Intermediate  90 54.40% 18.90% 2.22% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0412080354 G -> DEL N N silent_mutation Average:19.911; most accessible tissue: Callus, score: 41.793 N N N N
vg0412080354 G -> A LOC_Os04g21380.1 upstream_gene_variant ; 4428.0bp to feature; MODIFIER silent_mutation Average:19.911; most accessible tissue: Callus, score: 41.793 N N N N
vg0412080354 G -> A LOC_Os04g21370.1 downstream_gene_variant ; 855.0bp to feature; MODIFIER silent_mutation Average:19.911; most accessible tissue: Callus, score: 41.793 N N N N
vg0412080354 G -> A LOC_Os04g21370-LOC_Os04g21380 intergenic_region ; MODIFIER silent_mutation Average:19.911; most accessible tissue: Callus, score: 41.793 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0412080354 5.71E-06 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 2.98E-07 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 NA 3.51E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 3.66E-07 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 NA 3.84E-23 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 NA 2.40E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 4.00E-06 NA mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 7.36E-07 NA mr1549 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 NA 6.12E-09 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 NA 3.27E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 NA 5.99E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 8.74E-08 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 NA 7.89E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 4.62E-06 NA mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 NA 6.00E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 NA 2.45E-12 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 NA 7.89E-06 mr1905 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 NA 2.16E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 NA 1.16E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 NA 7.02E-10 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 NA 4.16E-20 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 8.54E-06 NA mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 NA 4.77E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 NA 2.08E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 NA 4.46E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 NA 1.77E-14 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0412080354 NA 1.77E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251