| Variant ID: vg0412080354 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 12080354 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTGGGAGATCTGCTTAACTCCAGTGCAGGTCCAAAATATTGATGAGATGTAGGCATTCCAATCAGTTTTATCCTGCAACTGACAAGACGTATGAAATGAA[G/A]
ATCAGAGAACCACTCGGCCAATAAGTTGATAGCAATGCTAGCCAATGCCAATACCAGCTGATGTCGATATGGTTTTGAGCAACCGGCTATATGTCCAATC
GATTGGACATATAGCCGGTTGCTCAAAACCATATCGACATCAGCTGGTATTGGCATTGGCTAGCATTGCTATCAACTTATTGGCCGAGTGGTTCTCTGAT[C/T]
TTCATTTCATACGTCTTGTCAGTTGCAGGATAAAACTGATTGGAATGCCTACATCTCATCAATATTTTGGACCTGCACTGGAGTTAAGCAGATCTCCCAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.00% | 13.40% | 1.65% | 22.89% | NA |
| All Indica | 2759 | 64.70% | 0.50% | 1.16% | 33.67% | NA |
| All Japonica | 1512 | 57.00% | 39.60% | 2.78% | 0.60% | NA |
| Aus | 269 | 54.60% | 0.00% | 0.74% | 44.61% | NA |
| Indica I | 595 | 78.20% | 0.00% | 1.01% | 20.84% | NA |
| Indica II | 465 | 54.00% | 1.30% | 1.29% | 43.44% | NA |
| Indica III | 913 | 68.60% | 0.20% | 0.55% | 30.67% | NA |
| Indica Intermediate | 786 | 56.40% | 0.60% | 1.91% | 41.09% | NA |
| Temperate Japonica | 767 | 92.40% | 3.10% | 4.43% | 0.00% | NA |
| Tropical Japonica | 504 | 9.30% | 89.70% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 44.00% | 51.00% | 3.32% | 1.66% | NA |
| VI/Aromatic | 96 | 91.70% | 6.20% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 54.40% | 18.90% | 2.22% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0412080354 | G -> DEL | N | N | silent_mutation | Average:19.911; most accessible tissue: Callus, score: 41.793 | N | N | N | N |
| vg0412080354 | G -> A | LOC_Os04g21380.1 | upstream_gene_variant ; 4428.0bp to feature; MODIFIER | silent_mutation | Average:19.911; most accessible tissue: Callus, score: 41.793 | N | N | N | N |
| vg0412080354 | G -> A | LOC_Os04g21370.1 | downstream_gene_variant ; 855.0bp to feature; MODIFIER | silent_mutation | Average:19.911; most accessible tissue: Callus, score: 41.793 | N | N | N | N |
| vg0412080354 | G -> A | LOC_Os04g21370-LOC_Os04g21380 | intergenic_region ; MODIFIER | silent_mutation | Average:19.911; most accessible tissue: Callus, score: 41.793 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0412080354 | 5.71E-06 | NA | mr1071 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412080354 | 2.98E-07 | NA | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412080354 | NA | 3.51E-10 | mr1178 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412080354 | 3.66E-07 | NA | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412080354 | NA | 3.84E-23 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412080354 | NA | 2.40E-06 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412080354 | 4.00E-06 | NA | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412080354 | 7.36E-07 | NA | mr1549 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412080354 | NA | 6.12E-09 | mr1552 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0412080354 | NA | 3.27E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/