\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411864054:

Variant ID: vg0411864054 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 11864054
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGCAATATAATTCTTAAAGATTAAATTCAATATTATAAGGTAATATCCATAGGATTAATGTGTATTGGCATATTGACATCGTGAAAAACCTCACCTAG[C/T]
ATATGCTTAGCTAAATTGATTCACCAAAATACTAAATTGTCAAGTTCTTGTACTAAACCGCACCCACTTGTCAAGTTGTTACACTCGGACGTTTAATTCT

Reverse complement sequence

AGAATTAAACGTCCGAGTGTAACAACTTGACAAGTGGGTGCGGTTTAGTACAAGAACTTGACAATTTAGTATTTTGGTGAATCAATTTAGCTAAGCATAT[G/A]
CTAGGTGAGGTTTTTCACGATGTCAATATGCCAATACACATTAATCCTATGGATATTACCTTATAATATTGAATTTAATCTTTAAGAATTATATTGCACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.90% 29.80% 1.25% 0.00% NA
All Indica  2759 57.40% 41.00% 1.59% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 11.20% 84.00% 4.83% 0.00% NA
Indica I  595 77.00% 21.80% 1.18% 0.00% NA
Indica II  465 51.60% 47.50% 0.86% 0.00% NA
Indica III  913 52.10% 45.90% 1.97% 0.00% NA
Indica Intermediate  786 52.00% 46.10% 1.91% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 12.50% 1.04% 0.00% NA
Intermediate  90 68.90% 30.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0411864054 C -> T LOC_Os04g21100.1 downstream_gene_variant ; 2154.0bp to feature; MODIFIER silent_mutation Average:23.411; most accessible tissue: Callus, score: 39.656 N N N N
vg0411864054 C -> T LOC_Os04g21100-LOC_Os04g21110 intergenic_region ; MODIFIER silent_mutation Average:23.411; most accessible tissue: Callus, score: 39.656 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0411864054 NA 7.19E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411864054 NA 3.43E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411864054 NA 3.14E-06 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411864054 NA 1.51E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411864054 NA 7.38E-18 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411864054 NA 7.58E-10 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411864054 4.18E-08 1.66E-23 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411864054 8.21E-08 1.70E-14 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411864054 NA 6.49E-07 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411864054 NA 2.10E-06 mr1608_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411864054 NA 2.81E-09 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411864054 NA 1.24E-06 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411864054 NA 8.09E-16 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411864054 NA 1.21E-11 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411864054 6.93E-08 8.68E-40 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411864054 4.43E-07 6.53E-26 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251