RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0411852309:

Variant ID: vg0411852309 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 11852309
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

TGCGACCATACTAGGTTGTTTGCTTAAGCAACTTGAATCATAAAATCCATTCACAACAGATCAATAGGCAAGTGGTTTAGTACCTCCTCTCTAGTAACCC[C/G]
TCCTATTTCCCCATCTCTCTATTGCCTGCAGCAGATGGTCCGCATGAGGGACAATTTCATCGGATCAAGACCCCGTCAGTTTCATGGGGCAACTCAGTGC

Reverse complement sequence

GCACTGAGTTGCCCCATGAAACTGACGGGGTCTTGATCCGATGAAATTGTCCCTCATGCGGACCATCTGCTGCAGGCAATAGAGAGATGGGGAAATAGGA[G/C]
GGGTTACTAGAGAGGAGGTACTAAACCACTTGCCTATTGATCTGTTGTGAATGGATTTTATGATTCAAGTTGCTTAAGCAAACAACCTAGTATGGTCGCA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.60%	9.30%	20.69%	35.34%	NA
All Indica	2759	26.80%	15.70%	24.90%	32.58%	NA
All Japonica	1512	51.40%	0.20%	2.25%	46.16%	NA
Aus	269	6.30%	0.00%	81.04%	12.64%	NA
Indica I	595	4.20%	30.40%	26.22%	39.16%	NA
Indica II	465	41.50%	22.20%	21.08%	15.27%	NA
Indica III	913	38.00%	1.80%	23.11%	37.13%	NA
Indica Intermediate	786	22.30%	16.90%	28.24%	32.57%	NA
Temperate Japonica	767	85.10%	0.00%	0.39%	14.47%	NA
Tropical Japonica	504	5.80%	0.20%	5.36%	88.69%	NA
Japonica Intermediate	241	39.40%	0.80%	1.66%	58.09%	NA
VI/Aromatic	96	69.80%	0.00%	18.75%	11.46%	NA
Intermediate	90	40.00%	5.60%	23.33%	31.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0411852309	C -> DEL	N	N	silent_mutation	Average:34.16; most accessible tissue: Minghui63 flag leaf, score: 64.284	N	N	N	N
vg0411852309	C -> G	LOC_Os04g21090.1	upstream_gene_variant ; 244.0bp to feature; MODIFIER	silent_mutation	Average:34.16; most accessible tissue: Minghui63 flag leaf, score: 64.284	N	N	N	N
vg0411852309	C -> G	LOC_Os04g21080-LOC_Os04g21090	intergenic_region ; MODIFIER	silent_mutation	Average:34.16; most accessible tissue: Minghui63 flag leaf, score: 64.284	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0411852309	1.43E-06	NA	mr1549	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411852309	NA	2.41E-06	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411852309	NA	7.03E-07	mr1654_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411852309	NA	4.24E-06	mr1654_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411852309	NA	5.14E-06	mr1757_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 5 of 5 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0411852309:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact