| Variant ID: vg0411837967 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 11837967 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 122. )
TGTCTAGCCGTAGGTGCATCCCTAAATTCCTACCGGCCTATCGTTTGCCGTACCGGGGCTTTACCGTGAATCGTTTCTAGCCCACCGGTTTAGCCGCAGC[C/T]
ATTGTTGAGTCGTTCGCTCGTTCGTTCGAACGAGGTGTTACCCGTGCTTCGTTCGTTTGTCCGTGTTGAGTCGTCCTTTAGTTTAGAGCCGTTTAGAGCC
GGCTCTAAACGGCTCTAAACTAAAGGACGACTCAACACGGACAAACGAACGAAGCACGGGTAACACCTCGTTCGAACGAACGAGCGAACGACTCAACAAT[G/A]
GCTGCGGCTAAACCGGTGGGCTAGAAACGATTCACGGTAAAGCCCCGGTACGGCAAACGATAGGCCGGTAGGAATTTAGGGATGCACCTACGGCTAGACA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.50% | 27.30% | 0.23% | 0.02% | NA |
| All Indica | 2759 | 53.30% | 46.30% | 0.36% | 0.04% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 25.40% | 73.90% | 0.67% | 0.00% | NA |
| Indica II | 465 | 74.00% | 25.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 57.10% | 42.60% | 0.22% | 0.11% | NA |
| Indica Intermediate | 786 | 57.80% | 41.90% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0411837967 | C -> DEL | N | N | silent_mutation | Average:57.228; most accessible tissue: Minghui63 young leaf, score: 77.243 | N | N | N | N |
| vg0411837967 | C -> T | LOC_Os04g21060.1 | downstream_gene_variant ; 1553.0bp to feature; MODIFIER | silent_mutation | Average:57.228; most accessible tissue: Minghui63 young leaf, score: 77.243 | N | N | N | N |
| vg0411837967 | C -> T | LOC_Os04g21050-LOC_Os04g21060 | intergenic_region ; MODIFIER | silent_mutation | Average:57.228; most accessible tissue: Minghui63 young leaf, score: 77.243 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0411837967 | NA | 2.17E-06 | mr1386 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411837967 | NA | 8.41E-12 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411837967 | NA | 2.14E-09 | mr1403 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411837967 | NA | 3.45E-06 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411837967 | 5.92E-07 | NA | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411837967 | 9.83E-07 | 1.63E-11 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411837967 | NA | 1.31E-08 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411837967 | 6.39E-08 | 3.23E-13 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411837967 | 1.43E-06 | 2.49E-22 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |