\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411823300:

Variant ID: vg0411823300 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 11823300
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAGATGACTCCGTGTCTTTGTAAAAAGAAACCCATCACTCTAAGCAATAAAATGGGAGGCAACTACACGTCAGGCGCCCGATCCGGGGTGGGAAAATC[G/A]
GGCGCCCACGTCATGTTGACGTCAGCATGACGTCAGCAAGATGTATGCGCGCAAAACTATTTTAAACTATTTTTTTATTTTAAATTATTTATCCAAATCA

Reverse complement sequence

TGATTTGGATAAATAATTTAAAATAAAAAAATAGTTTAAAATAGTTTTGCGCGCATACATCTTGCTGACGTCATGCTGACGTCAACATGACGTGGGCGCC[C/T]
GATTTTCCCACCCCGGATCGGGCGCCTGACGTGTAGTTGCCTCCCATTTTATTGCTTAGAGTGATGGGTTTCTTTTTACAAAGACACGGAGTCATCTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 4.50% 4.68% 0.00% NA
All Indica  2759 99.70% 0.10% 0.22% 0.00% NA
All Japonica  1512 72.60% 13.40% 14.02% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.40% 0.00% 0.65% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.10% 0.25% 0.00% NA
Temperate Japonica  767 50.50% 24.90% 24.64% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 86.70% 3.70% 9.54% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 6.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0411823300 G -> A LOC_Os04g21030.1 upstream_gene_variant ; 1903.0bp to feature; MODIFIER silent_mutation Average:51.507; most accessible tissue: Callus, score: 76.523 N N N N
vg0411823300 G -> A LOC_Os04g21040.1 upstream_gene_variant ; 4245.0bp to feature; MODIFIER silent_mutation Average:51.507; most accessible tissue: Callus, score: 76.523 N N N N
vg0411823300 G -> A LOC_Os04g21020.1 downstream_gene_variant ; 778.0bp to feature; MODIFIER silent_mutation Average:51.507; most accessible tissue: Callus, score: 76.523 N N N N
vg0411823300 G -> A LOC_Os04g21020-LOC_Os04g21030 intergenic_region ; MODIFIER silent_mutation Average:51.507; most accessible tissue: Callus, score: 76.523 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0411823300 NA 3.92E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 3.73E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 1.87E-11 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 2.47E-11 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 5.02E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 1.96E-08 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 1.34E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 5.47E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 2.06E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 1.16E-08 2.33E-14 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 2.87E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 9.63E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 6.73E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 9.48E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 9.75E-09 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 5.37E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 3.82E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 4.46E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 4.32E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 3.94E-07 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 1.81E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 1.11E-08 NA mr1631_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 1.39E-06 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 7.82E-06 1.72E-10 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 3.07E-07 mr1748_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 3.65E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411823300 NA 7.02E-09 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251