\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411806765:

Variant ID: vg0411806765 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 11806765
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCATGTACTCGGCCTCGCAGCTGGACAGGGCCACCACCTGCTGCTTGACTGACTGCCAGCTAACGAGGCACTCGCCGAGGAAGAAGAGAATCCCGCTCG[T/A]
GCTCTTGCTGGTGTCGATGTCACCGGCGTGGTTGCTGTTGCTGTACTCGACGAAGTGTGCCTTGCCAGGACACCTCGGGTAGTAGAGACCGTGGTCGAGA

Reverse complement sequence

TCTCGACCACGGTCTCTACTACCCGAGGTGTCCTGGCAAGGCACACTTCGTCGAGTACAGCAACAGCAACCACGCCGGTGACATCGACACCAGCAAGAGC[A/T]
CGAGCGGGATTCTCTTCTTCCTCGGCGAGTGCCTCGTTAGCTGGCAGTCAGTCAAGCAGCAGGTGGTGGCCCTGTCCAGCTGCGAGGCCGAGTACATGGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.00% 2.00% 19.11% 56.90% NA
All Indica  2759 7.20% 3.00% 21.02% 68.76% NA
All Japonica  1512 51.00% 0.80% 8.27% 39.95% NA
Aus  269 8.20% 0.00% 44.61% 47.21% NA
Indica I  595 4.20% 2.70% 8.07% 85.04% NA
Indica II  465 17.60% 3.00% 26.88% 52.47% NA
Indica III  913 4.40% 2.80% 26.07% 66.70% NA
Indica Intermediate  786 6.70% 3.30% 21.50% 68.45% NA
Temperate Japonica  767 85.30% 0.10% 1.83% 12.78% NA
Tropical Japonica  504 4.60% 1.80% 12.90% 80.75% NA
Japonica Intermediate  241 39.00% 0.80% 19.09% 41.08% NA
VI/Aromatic  96 24.00% 0.00% 53.12% 22.92% NA
Intermediate  90 24.40% 2.20% 30.00% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0411806765 T -> DEL N N silent_mutation Average:29.489; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0411806765 T -> A LOC_Os04g20990.1 intron_variant ; MODIFIER silent_mutation Average:29.489; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0411806765 1.43E-06 NA mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411806765 6.16E-06 NA mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411806765 6.45E-08 4.01E-08 mr1089_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411806765 1.50E-07 6.93E-08 mr1093_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411806765 9.69E-06 NA mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411806765 3.18E-06 NA mr1235_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411806765 NA 8.47E-06 mr1248_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411806765 1.54E-06 5.04E-07 mr1251_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411806765 1.33E-06 4.54E-07 mr1435_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411806765 1.25E-06 NA mr1599_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251