\
| Variant ID: vg0411806765 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 11806765 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCCATGTACTCGGCCTCGCAGCTGGACAGGGCCACCACCTGCTGCTTGACTGACTGCCAGCTAACGAGGCACTCGCCGAGGAAGAAGAGAATCCCGCTCG[T/A]
GCTCTTGCTGGTGTCGATGTCACCGGCGTGGTTGCTGTTGCTGTACTCGACGAAGTGTGCCTTGCCAGGACACCTCGGGTAGTAGAGACCGTGGTCGAGA
TCTCGACCACGGTCTCTACTACCCGAGGTGTCCTGGCAAGGCACACTTCGTCGAGTACAGCAACAGCAACCACGCCGGTGACATCGACACCAGCAAGAGC[A/T]
CGAGCGGGATTCTCTTCTTCCTCGGCGAGTGCCTCGTTAGCTGGCAGTCAGTCAAGCAGCAGGTGGTGGCCCTGTCCAGCTGCGAGGCCGAGTACATGGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 22.00% | 2.00% | 19.11% | 56.90% | NA |
| All Indica | 2759 | 7.20% | 3.00% | 21.02% | 68.76% | NA |
| All Japonica | 1512 | 51.00% | 0.80% | 8.27% | 39.95% | NA |
| Aus | 269 | 8.20% | 0.00% | 44.61% | 47.21% | NA |
| Indica I | 595 | 4.20% | 2.70% | 8.07% | 85.04% | NA |
| Indica II | 465 | 17.60% | 3.00% | 26.88% | 52.47% | NA |
| Indica III | 913 | 4.40% | 2.80% | 26.07% | 66.70% | NA |
| Indica Intermediate | 786 | 6.70% | 3.30% | 21.50% | 68.45% | NA |
| Temperate Japonica | 767 | 85.30% | 0.10% | 1.83% | 12.78% | NA |
| Tropical Japonica | 504 | 4.60% | 1.80% | 12.90% | 80.75% | NA |
| Japonica Intermediate | 241 | 39.00% | 0.80% | 19.09% | 41.08% | NA |
| VI/Aromatic | 96 | 24.00% | 0.00% | 53.12% | 22.92% | NA |
| Intermediate | 90 | 24.40% | 2.20% | 30.00% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0411806765 | T -> DEL | N | N | silent_mutation | Average:29.489; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| vg0411806765 | T -> A | LOC_Os04g20990.1 | intron_variant ; MODIFIER | silent_mutation | Average:29.489; most accessible tissue: Zhenshan97 panicle, score: 49.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0411806765 | 1.43E-06 | NA | mr1071_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411806765 | 6.16E-06 | NA | mr1080_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411806765 | 6.45E-08 | 4.01E-08 | mr1089_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411806765 | 1.50E-07 | 6.93E-08 | mr1093_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411806765 | 9.69E-06 | NA | mr1203_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411806765 | 3.18E-06 | NA | mr1235_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411806765 | NA | 8.47E-06 | mr1248_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411806765 | 1.54E-06 | 5.04E-07 | mr1251_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411806765 | 1.33E-06 | 4.54E-07 | mr1435_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411806765 | 1.25E-06 | NA | mr1599_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |