\
| Variant ID: vg0411710445 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 11710445 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 76. )
TTGTTGGGAGGAAGCCTAATGTCGTCTATTTTCAAGTTTTTGGTTGCAAGTGTTATATTTACCGAAAGGGTGTTAGACTAACCAAATTTGAAAGTCGGTG[C/T]
GATGAAGGGTTTCTTCTAGGTTATGCCTCAAATAGCAAGGCATACCGGGTCTACAACAAGAACAAAAGTATTGTGGAAGAAACCGACGATGTTCAATTTG
CAAATTGAACATCGTCGGTTTCTTCCACAATACTTTTGTTCTTGTTGTAGACCCGGTATGCCTTGCTATTTGAGGCATAACCTAGAAGAAACCCTTCATC[G/A]
CACCGACTTTCAAATTTGGTTAGTCTAACACCCTTTCGGTAAATATAACACTTGCAACCAAAAACTTGAAAATAGACGACATTAGGCTTCCTCCCAACAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.10% | 0.30% | 8.99% | 60.60% | NA |
| All Indica | 2759 | 2.10% | 0.40% | 8.92% | 88.58% | NA |
| All Japonica | 1512 | 87.50% | 0.00% | 2.45% | 10.05% | NA |
| Aus | 269 | 0.40% | 1.50% | 30.86% | 67.29% | NA |
| Indica I | 595 | 1.00% | 0.30% | 1.01% | 97.65% | NA |
| Indica II | 465 | 4.50% | 0.40% | 13.12% | 81.94% | NA |
| Indica III | 913 | 1.50% | 0.50% | 13.58% | 84.34% | NA |
| Indica Intermediate | 786 | 2.30% | 0.10% | 7.00% | 90.59% | NA |
| Temperate Japonica | 767 | 91.50% | 0.00% | 0.39% | 8.08% | NA |
| Tropical Japonica | 504 | 90.10% | 0.00% | 2.78% | 7.14% | NA |
| Japonica Intermediate | 241 | 69.30% | 0.00% | 8.30% | 22.41% | NA |
| VI/Aromatic | 96 | 7.30% | 0.00% | 51.04% | 41.67% | NA |
| Intermediate | 90 | 36.70% | 0.00% | 11.11% | 52.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0411710445 | C -> DEL | LOC_Os04g20860.1 | N | frameshift_variant | Average:12.044; most accessible tissue: Callus, score: 26.675 | N | N | N | N |
| vg0411710445 | C -> T | LOC_Os04g20860.1 | synonymous_variant ; p.Cys184Cys; LOW | synonymous_codon | Average:12.044; most accessible tissue: Callus, score: 26.675 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0411710445 | NA | 5.17E-90 | mr1071 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411710445 | NA | 3.96E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411710445 | NA | 1.69E-15 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411710445 | NA | 3.61E-28 | mr1298 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411710445 | NA | 7.00E-17 | mr1324 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411710445 | NA | 3.29E-13 | mr1335 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411710445 | 1.59E-06 | NA | mr1343 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411710445 | NA | 1.70E-66 | mr1619 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411710445 | NA | 7.64E-08 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411710445 | NA | 6.53E-10 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411710445 | NA | 4.02E-18 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411710445 | NA | 5.33E-10 | mr1806 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411710445 | 1.90E-06 | NA | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411710445 | 5.06E-07 | NA | mr1842 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411710445 | NA | 1.25E-17 | mr1968 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411710445 | NA | 2.72E-20 | mr1298_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411710445 | NA | 8.00E-16 | mr1416_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411710445 | NA | 1.80E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411710445 | NA | 5.78E-15 | mr1686_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411710445 | NA | 7.61E-10 | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411710445 | 7.47E-06 | NA | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |