\
| Variant ID: vg0411669926 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 11669926 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 70. )
ATCATTATTGCTTTCCTTCCGAGAGTCCCCTTTCCCCGTAGTCTCCCTTTATGGCGTGATTCAGGTATCCCGATTGGGCGATGCTTGCCTCTGGACGAGC[G/A]
CGGTTACGAACATACTTCTTCAGAACGCCCATGTACTTCTTGAAAGGAAACATGTTGTGTAGGTACACAGGACCGAGAATACCGATCTCTTTGACAAGGT
ACCTTGTCAAAGAGATCGGTATTCTCGGTCCTGTGTACCTACACAACATGTTTCCTTTCAAGAAGTACATGGGCGTTCTGAAGAAGTATGTTCGTAACCG[C/T]
GCTCGTCCAGAGGCAAGCATCGCCCAATCGGGATACCTGAATCACGCCATAAAGGGAGACTACGGGGAAAGGGGACTCTCGGAAGGAAAGCAATAATGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.20% | 5.70% | 6.47% | 57.62% | NA |
| All Indica | 2759 | 2.20% | 0.20% | 7.58% | 90.00% | NA |
| All Japonica | 1512 | 87.40% | 11.60% | 0.13% | 0.86% | NA |
| Aus | 269 | 1.10% | 0.00% | 31.97% | 66.91% | NA |
| Indica I | 595 | 1.30% | 0.20% | 1.01% | 97.48% | NA |
| Indica II | 465 | 4.90% | 0.20% | 13.33% | 81.51% | NA |
| Indica III | 913 | 1.30% | 0.00% | 10.19% | 88.50% | NA |
| Indica Intermediate | 786 | 2.40% | 0.40% | 6.11% | 91.09% | NA |
| Temperate Japonica | 767 | 92.00% | 7.60% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 89.90% | 8.70% | 0.20% | 1.19% | NA |
| Japonica Intermediate | 241 | 67.20% | 30.70% | 0.41% | 1.66% | NA |
| VI/Aromatic | 96 | 6.20% | 79.20% | 5.21% | 9.38% | NA |
| Intermediate | 90 | 38.90% | 14.40% | 4.44% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0411669926 | G -> DEL | N | N | silent_mutation | Average:12.197; most accessible tissue: Callus, score: 25.707 | N | N | N | N |
| vg0411669926 | G -> A | LOC_Os04g20800.1 | upstream_gene_variant ; 3470.0bp to feature; MODIFIER | silent_mutation | Average:12.197; most accessible tissue: Callus, score: 25.707 | N | N | N | N |
| vg0411669926 | G -> A | LOC_Os04g20790.1 | intron_variant ; MODIFIER | silent_mutation | Average:12.197; most accessible tissue: Callus, score: 25.707 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0411669926 | 7.83E-07 | 1.15E-08 | mr1343 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411669926 | 5.17E-07 | 9.70E-13 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411669926 | 7.80E-08 | 8.02E-17 | mr1842 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411669926 | NA | 1.80E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411669926 | NA | 1.03E-06 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411669926 | NA | 4.58E-14 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411669926 | 9.69E-06 | 3.76E-17 | mr1842_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |