\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411665882:

Variant ID: vg0411665882 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 11665882
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGCGGCATTGTTTTTGTTTCTGGCCATCATCGCTTGCCCTTGTTGCCCTGTCTTGTAAGCAACGAACTCGTCCCAATGATCCCTTAGCTTTGGGAATAC[A/G]
TCGAAGTTCGGTGTTAGGTTAGTCCCTTCAAGATGTATTTCTTGTAGAGATCTCCCTTGAAGCTCTGGAACTGTTCTGCCATTTTCTTCAGAGTCCACTG

Reverse complement sequence

CAGTGGACTCTGAAGAAAATGGCAGAACAGTTCCAGAGCTTCAAGGGAGATCTCTACAAGAAATACATCTTGAAGGGACTAACCTAACACCGAACTTCGA[T/C]
GTATTCCCAAAGCTAAGGGATCATTGGGACGAGTTCGTTGCTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGCCAGAAACAAAAACAATGCCGCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.80% 0.10% 2.52% 0.53% NA
All Indica  2759 99.50% 0.20% 0.29% 0.00% NA
All Japonica  1512 91.00% 0.00% 7.34% 1.65% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.30% 0.30% 0.34% 0.00% NA
Indica II  465 98.90% 0.20% 0.86% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.10% 0.25% 0.00% NA
Temperate Japonica  767 83.70% 0.00% 13.30% 3.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 95.40% 0.00% 3.73% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0411665882 A -> DEL LOC_Os04g20790.1 N frameshift_variant Average:21.715; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0411665882 A -> G LOC_Os04g20790.1 synonymous_variant ; p.Asp900Asp; LOW synonymous_codon Average:21.715; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0411665882 5.93E-06 1.23E-06 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411665882 9.95E-06 2.10E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411665882 6.49E-06 6.48E-06 mr1311_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411665882 9.42E-06 9.42E-06 mr1337_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411665882 4.46E-07 4.46E-07 mr1374_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411665882 1.78E-06 1.78E-06 mr1663_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411665882 9.75E-06 9.75E-06 mr1760_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411665882 6.22E-06 6.22E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251