\
| Variant ID: vg0411665882 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 11665882 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGGCGGCATTGTTTTTGTTTCTGGCCATCATCGCTTGCCCTTGTTGCCCTGTCTTGTAAGCAACGAACTCGTCCCAATGATCCCTTAGCTTTGGGAATAC[A/G]
TCGAAGTTCGGTGTTAGGTTAGTCCCTTCAAGATGTATTTCTTGTAGAGATCTCCCTTGAAGCTCTGGAACTGTTCTGCCATTTTCTTCAGAGTCCACTG
CAGTGGACTCTGAAGAAAATGGCAGAACAGTTCCAGAGCTTCAAGGGAGATCTCTACAAGAAATACATCTTGAAGGGACTAACCTAACACCGAACTTCGA[T/C]
GTATTCCCAAAGCTAAGGGATCATTGGGACGAGTTCGTTGCTTACAAGACAGGGCAACAAGGGCAAGCGATGATGGCCAGAAACAAAAACAATGCCGCCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.80% | 0.10% | 2.52% | 0.53% | NA |
| All Indica | 2759 | 99.50% | 0.20% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 91.00% | 0.00% | 7.34% | 1.65% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.20% | 0.86% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 83.70% | 0.00% | 13.30% | 3.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 0.00% | 3.73% | 0.83% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0411665882 | A -> DEL | LOC_Os04g20790.1 | N | frameshift_variant | Average:21.715; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0411665882 | A -> G | LOC_Os04g20790.1 | synonymous_variant ; p.Asp900Asp; LOW | synonymous_codon | Average:21.715; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0411665882 | 5.93E-06 | 1.23E-06 | mr1184_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411665882 | 9.95E-06 | 2.10E-06 | mr1278_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411665882 | 6.49E-06 | 6.48E-06 | mr1311_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411665882 | 9.42E-06 | 9.42E-06 | mr1337_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411665882 | 4.46E-07 | 4.46E-07 | mr1374_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411665882 | 1.78E-06 | 1.78E-06 | mr1663_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411665882 | 9.75E-06 | 9.75E-06 | mr1760_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411665882 | 6.22E-06 | 6.22E-06 | mr1833_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |