RiceVarMap2

Detailed information for vg0411642803:

Variant ID: vg0411642803 (JBrowse)

Variation Type: SNP

Chromosome: chr04

Position: 11642803

Reference Allele: A

Alternative Allele: G

Primary Allele: G

Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.56, A: 0.44, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

GTGGTTTGACGGGCACATCTTAGGCTGAAGTTGACTGGCAGGCTAAAGGCCTAGCAATGTCTCCAATATTCTTCTCTCGAGGCATTGGATGTTTCATTAT[A/G]
TTTGTTTGATGACTTGAATTATTCACTTCATCCCTCAAATATAATGGAAGGTCCGGAAAGACTACGACAAATATTCTTCTTGAGTAATTTAGATTTATCT

Reverse complement sequence

AGATAAATCTAAATTACTCAAGAAGAATATTTGTCGTAGTCTTTCCGGACCTTCCATTATATTTGAGGGATGAAGTGAATAATTCAAGTCATCAAACAAA[T/C]
ATAATGAAACATCCAATGCCTCGAGAGAAGAATATTGGAGACATTGCTAGGCCTTTAGCCTGCCAGTCAACTTCAGCCTAAGATGTGCCCGTCAAACCAC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.00%	17.40%	3.79%	5.80%	NA
All Indica	2759	91.60%	1.30%	6.20%	0.91%	NA
All Japonica	1512	37.80%	50.80%	0.20%	11.18%	NA
Aus	269	98.50%	0.70%	0.74%	0.00%	NA
Indica I	595	96.80%	0.30%	2.52%	0.34%	NA
Indica II	465	75.70%	2.60%	20.22%	1.51%	NA
Indica III	913	94.90%	1.30%	2.85%	0.99%	NA
Indica Intermediate	786	93.30%	1.30%	4.58%	0.89%	NA
Temperate Japonica	767	7.60%	85.10%	0.00%	7.30%	NA
Tropical Japonica	504	87.10%	4.20%	0.20%	8.53%	NA
Japonica Intermediate	241	31.10%	39.00%	0.83%	29.05%	NA
VI/Aromatic	96	27.10%	0.00%	0.00%	72.92%	NA
Intermediate	90	67.80%	17.80%	3.33%	11.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0411642803	A -> DEL	N	N	silent_mutation	Average:28.394; most accessible tissue: Minghui63 flag leaf, score: 35.832	N	N	N	N
vg0411642803	A -> G	LOC_Os04g20749.1	3_prime_UTR_variant ; 3810.0bp to feature; MODIFIER	silent_mutation	Average:28.394; most accessible tissue: Minghui63 flag leaf, score: 35.832	N	N	N	N
vg0411642803	A -> G	LOC_Os04g20749.2	3_prime_UTR_variant ; 3810.0bp to feature; MODIFIER	silent_mutation	Average:28.394; most accessible tissue: Minghui63 flag leaf, score: 35.832	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0411642803	NA	6.68E-10	mr1580	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411642803	NA	9.11E-08	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg0411642803:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact