| Variant ID: vg0411635886 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 11635886 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 277. )
TATTTTACTTTTTCATTTTCCGCCATAAATAAAGACCCTTGTTCTAGGAGTATGATTGATTATCTTCTTGAGTCAATATTTTTGGCTTTGCACTATATAT[G/A]
ATGCAGGTATGTCACAGTTTATCCCTACCAAGCTCCACATATCAGCCTTCTAATAGGGATGAATTATGGCACATTTTGCCTTGGTAAGGATCCAAAAAGA
TCTTTTTGGATCCTTACCAAGGCAAAATGTGCCATAATTCATCCCTATTAGAAGGCTGATATGTGGAGCTTGGTAGGGATAAACTGTGACATACCTGCAT[C/T]
ATATATAGTGCAAAGCCAAAAATATTGACTCAAGAAGATAATCAATCATACTCCTAGAACAAGGGTCTTTATTTATGGCGGAAAATGAAAAAGTAAAATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.80% | 17.10% | 5.71% | 3.41% | NA |
| All Indica | 2759 | 61.40% | 29.00% | 9.53% | 0.07% | NA |
| All Japonica | 1512 | 89.80% | 0.10% | 0.13% | 9.99% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 30.90% | 56.00% | 12.94% | 0.17% | NA |
| Indica II | 465 | 77.00% | 20.20% | 2.58% | 0.22% | NA |
| Indica III | 913 | 69.30% | 19.80% | 10.84% | 0.00% | NA |
| Indica Intermediate | 786 | 66.00% | 24.40% | 9.54% | 0.00% | NA |
| Temperate Japonica | 767 | 93.00% | 0.00% | 0.13% | 6.91% | NA |
| Tropical Japonica | 504 | 92.30% | 0.20% | 0.00% | 7.54% | NA |
| Japonica Intermediate | 241 | 74.70% | 0.00% | 0.41% | 24.90% | NA |
| VI/Aromatic | 96 | 89.60% | 1.00% | 2.08% | 7.29% | NA |
| Intermediate | 90 | 87.80% | 7.80% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0411635886 | G -> DEL | N | N | silent_mutation | Average:37.183; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg0411635886 | G -> A | LOC_Os04g20749.1 | upstream_gene_variant ; 2489.0bp to feature; MODIFIER | silent_mutation | Average:37.183; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg0411635886 | G -> A | LOC_Os04g20749.2 | upstream_gene_variant ; 2489.0bp to feature; MODIFIER | silent_mutation | Average:37.183; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg0411635886 | G -> A | LOC_Os04g20740.1 | downstream_gene_variant ; 1156.0bp to feature; MODIFIER | silent_mutation | Average:37.183; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg0411635886 | G -> A | LOC_Os04g20740-LOC_Os04g20749 | intergenic_region ; MODIFIER | silent_mutation | Average:37.183; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0411635886 | 1.00E-06 | NA | mr1846_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411635886 | 3.28E-06 | 2.74E-08 | mr1846_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411635886 | 6.89E-06 | 6.98E-06 | mr1976_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |