Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411635497:

Variant ID: vg0411635497 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 11635497
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTGACTTGTGTTAGATATCTTTCATACTCTCATGATCAAGGGGTCATTATCATTACCACTTTCCATTTCCACATATAAAATTAAGCTAAGCTTCTACA[C/T]
TAGAAGTTGGCTTTCCACAAAAATATCCATTCAAATAAACTCCTACATTGAACTATGCTTTCTTCTCCTAGAAAAGTTCTTGGCAAAAAGAAAATGAGAA

Reverse complement sequence

TTCTCATTTTCTTTTTGCCAAGAACTTTTCTAGGAGAAGAAAGCATAGTTCAATGTAGGAGTTTATTTGAATGGATATTTTTGTGGAAAGCCAACTTCTA[G/A]
TGTAGAAGCTTAGCTTAATTTTATATGTGGAAATGGAAAGTGGTAATGATAATGACCCCTTGATCATGAGAGTATGAAAGATATCTAACACAAGTCACAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.70%	13.20%	0.42%	3.70%	NA
All Indica	2759	98.30%	1.60%	0.04%	0.04%	NA
All Japonica	1512	52.30%	36.80%	0.60%	10.25%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.00%	0.17%	NA
Indica II	465	97.80%	1.90%	0.22%	0.00%	NA
Indica III	913	97.40%	2.60%	0.00%	0.00%	NA
Indica Intermediate	786	98.60%	1.40%	0.00%	0.00%	NA
Temperate Japonica	767	85.90%	6.90%	0.39%	6.78%	NA
Tropical Japonica	504	5.20%	86.30%	0.40%	8.13%	NA
Japonica Intermediate	241	44.00%	28.60%	1.66%	25.73%	NA
VI/Aromatic	96	68.80%	6.20%	8.33%	16.67%	NA
Intermediate	90	75.60%	18.90%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0411635497	C -> DEL	N	N	silent_mutation	Average:31.829; most accessible tissue: Minghui63 flag leaf, score: 44.406	N	N	N	N
vg0411635497	C -> T	LOC_Os04g20749.1	upstream_gene_variant ; 2878.0bp to feature; MODIFIER	silent_mutation	Average:31.829; most accessible tissue: Minghui63 flag leaf, score: 44.406	N	N	N	N
vg0411635497	C -> T	LOC_Os04g20749.2	upstream_gene_variant ; 2878.0bp to feature; MODIFIER	silent_mutation	Average:31.829; most accessible tissue: Minghui63 flag leaf, score: 44.406	N	N	N	N
vg0411635497	C -> T	LOC_Os04g20740.1	downstream_gene_variant ; 767.0bp to feature; MODIFIER	silent_mutation	Average:31.829; most accessible tissue: Minghui63 flag leaf, score: 44.406	N	N	N	N
vg0411635497	C -> T	LOC_Os04g20740-LOC_Os04g20749	intergenic_region ; MODIFIER	silent_mutation	Average:31.829; most accessible tissue: Minghui63 flag leaf, score: 44.406	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0411635497	2.35E-08	NA	mr1071	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497	2.21E-06	NA	mr1080	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497	1.08E-07	NA	mr1140	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497	6.06E-08	NA	mr1203	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497	NA	9.18E-22	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497	NA	2.83E-15	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497	NA	3.64E-07	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497	NA	6.95E-10	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497	1.63E-07	NA	mr1618	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497	NA	6.72E-07	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497	NA	7.99E-09	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497	2.93E-10	NA	mr1071_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497	2.73E-11	NA	mr1080_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497	1.87E-07	NA	mr1100_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497	3.85E-12	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497	NA	9.66E-22	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497	NA	1.08E-15	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497	NA	7.04E-08	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497	1.31E-09	NA	mr1613_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497	5.20E-09	NA	mr1619_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251