\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411635497:

Variant ID: vg0411635497 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 11635497
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTGACTTGTGTTAGATATCTTTCATACTCTCATGATCAAGGGGTCATTATCATTACCACTTTCCATTTCCACATATAAAATTAAGCTAAGCTTCTACA[C/T]
TAGAAGTTGGCTTTCCACAAAAATATCCATTCAAATAAACTCCTACATTGAACTATGCTTTCTTCTCCTAGAAAAGTTCTTGGCAAAAAGAAAATGAGAA

Reverse complement sequence

TTCTCATTTTCTTTTTGCCAAGAACTTTTCTAGGAGAAGAAAGCATAGTTCAATGTAGGAGTTTATTTGAATGGATATTTTTGTGGAAAGCCAACTTCTA[G/A]
TGTAGAAGCTTAGCTTAATTTTATATGTGGAAATGGAAAGTGGTAATGATAATGACCCCTTGATCATGAGAGTATGAAAGATATCTAACACAAGTCACAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.70% 13.20% 0.42% 3.70% NA
All Indica  2759 98.30% 1.60% 0.04% 0.04% NA
All Japonica  1512 52.30% 36.80% 0.60% 10.25% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 97.80% 1.90% 0.22% 0.00% NA
Indica III  913 97.40% 2.60% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.40% 0.00% 0.00% NA
Temperate Japonica  767 85.90% 6.90% 0.39% 6.78% NA
Tropical Japonica  504 5.20% 86.30% 0.40% 8.13% NA
Japonica Intermediate  241 44.00% 28.60% 1.66% 25.73% NA
VI/Aromatic  96 68.80% 6.20% 8.33% 16.67% NA
Intermediate  90 75.60% 18.90% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0411635497 C -> DEL N N silent_mutation Average:31.829; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N
vg0411635497 C -> T LOC_Os04g20749.1 upstream_gene_variant ; 2878.0bp to feature; MODIFIER silent_mutation Average:31.829; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N
vg0411635497 C -> T LOC_Os04g20749.2 upstream_gene_variant ; 2878.0bp to feature; MODIFIER silent_mutation Average:31.829; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N
vg0411635497 C -> T LOC_Os04g20740.1 downstream_gene_variant ; 767.0bp to feature; MODIFIER silent_mutation Average:31.829; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N
vg0411635497 C -> T LOC_Os04g20740-LOC_Os04g20749 intergenic_region ; MODIFIER silent_mutation Average:31.829; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0411635497 2.35E-08 NA mr1071 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497 2.21E-06 NA mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497 1.08E-07 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497 6.06E-08 NA mr1203 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497 NA 9.18E-22 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497 NA 2.83E-15 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497 NA 3.64E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497 NA 6.95E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497 1.63E-07 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497 NA 6.72E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497 NA 7.99E-09 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497 2.93E-10 NA mr1071_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497 2.73E-11 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497 1.87E-07 NA mr1100_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497 3.85E-12 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497 NA 9.66E-22 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497 NA 1.08E-15 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497 NA 7.04E-08 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497 1.31E-09 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411635497 5.20E-09 NA mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251