\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411627027:

Variant ID: vg0411627027 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 11627027
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


CGGTCCTATAGAGCAAGATAAGAGTTTTAAAATCAAAACATGAGACATAAAGTAAAATAATCTCTAAAGAAGGATGAGATATAAGATTGAACATGATTTT[T/C]
GCAAATAATTTGTAACTGAGAGCATAGCACTCAAAATAATTTTTAAGAAGCAATTCTAAGTGACAACTTAAGGGGCTCCTGTAGTCGGTATTTGCTCTGA

Reverse complement sequence

TCAGAGCAAATACCGACTACAGGAGCCCCTTAAGTTGTCACTTAGAATTGCTTCTTAAAAATTATTTTGAGTGCTATGCTCTCAGTTACAAATTATTTGC[A/G]
AAAATCATGTTCAATCTTATATCTCATCCTTCTTTAGAGATTATTTTACTTTATGTCTCATGTTTTGATTTTAAAACTCTTATCTTGCTCTATAGGACCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.30% 27.40% 21.43% 9.88% NA
All Indica  2759 13.00% 42.80% 30.23% 14.03% NA
All Japonica  1512 90.50% 0.30% 4.56% 4.63% NA
Aus  269 30.90% 33.50% 33.09% 2.60% NA
Indica I  595 1.80% 35.50% 42.52% 20.17% NA
Indica II  465 6.20% 53.30% 30.75% 9.68% NA
Indica III  913 23.20% 46.10% 19.72% 10.95% NA
Indica Intermediate  786 13.50% 38.20% 32.82% 15.52% NA
Temperate Japonica  767 93.90% 0.10% 0.91% 5.08% NA
Tropical Japonica  504 85.90% 0.60% 9.92% 3.57% NA
Japonica Intermediate  241 89.60% 0.00% 4.98% 5.39% NA
VI/Aromatic  96 85.40% 4.20% 10.42% 0.00% NA
Intermediate  90 65.60% 18.90% 12.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0411627027 T -> C LOC_Os04g20730.1 upstream_gene_variant ; 1510.0bp to feature; MODIFIER silent_mutation Average:9.844; most accessible tissue: Zhenshan97 flower, score: 13.891 N N N N
vg0411627027 T -> C LOC_Os04g20730-LOC_Os04g20740 intergenic_region ; MODIFIER silent_mutation Average:9.844; most accessible tissue: Zhenshan97 flower, score: 13.891 N N N N
vg0411627027 T -> DEL N N silent_mutation Average:9.844; most accessible tissue: Zhenshan97 flower, score: 13.891 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0411627027 NA 3.48E-06 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411627027 NA 1.75E-07 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411627027 NA 7.93E-06 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411627027 NA 1.02E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411627027 NA 3.11E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411627027 NA 2.18E-51 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411627027 NA 8.46E-25 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411627027 NA 4.64E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411627027 NA 2.81E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411627027 8.08E-06 9.33E-09 mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411627027 6.91E-07 2.99E-09 mr1619_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411627027 NA 1.13E-34 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411627027 NA 2.83E-19 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251