\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411580078:

Variant ID: vg0411580078 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 11580078
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGATGAAAATAGTTTTTTTTTTATGTCTTTGAGTCGATTTATTGTATAGAGTAGACATAATTTATTTTCTCTTTTAAAAATTAGCTCGGTTGATCATT[C/T]
GACTCTACTTTAAATTTAATAGCTTCAGTCAATGGTGAGGACCACGTAAAAAATATTTGCTCAAACTGTGATCTTTGCTAACATATGAGTTAATACAAGT

Reverse complement sequence

ACTTGTATTAACTCATATGTTAGCAAAGATCACAGTTTGAGCAAATATTTTTTACGTGGTCCTCACCATTGACTGAAGCTATTAAATTTAAAGTAGAGTC[G/A]
AATGATCAACCGAGCTAATTTTTAAAAGAGAAAATAAATTATGTCTACTCTATACAATAAATCGACTCAAAGACATAAAAAAAAAACTATTTTCATCATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.40% 5.60% 0.04% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 88.20% 11.80% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 92.30% 7.70% 0.00% 0.00% NA
Tropical Japonica  504 91.30% 8.70% 0.00% 0.00% NA
Japonica Intermediate  241 68.90% 31.10% 0.00% 0.00% NA
VI/Aromatic  96 20.80% 77.10% 2.08% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0411580078 C -> T LOC_Os04g20680-LOC_Os04g20690 intergenic_region ; MODIFIER silent_mutation Average:46.315; most accessible tissue: Zhenshan97 young leaf, score: 60.208 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0411580078 NA 9.36E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411580078 3.67E-06 NA mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411580078 3.34E-06 NA mr1789 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411580078 NA 1.75E-09 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411580078 NA 1.80E-06 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411580078 NA 1.22E-11 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251