\
| Variant ID: vg0411580078 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 11580078 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GATGATGAAAATAGTTTTTTTTTTATGTCTTTGAGTCGATTTATTGTATAGAGTAGACATAATTTATTTTCTCTTTTAAAAATTAGCTCGGTTGATCATT[C/T]
GACTCTACTTTAAATTTAATAGCTTCAGTCAATGGTGAGGACCACGTAAAAAATATTTGCTCAAACTGTGATCTTTGCTAACATATGAGTTAATACAAGT
ACTTGTATTAACTCATATGTTAGCAAAGATCACAGTTTGAGCAAATATTTTTTACGTGGTCCTCACCATTGACTGAAGCTATTAAATTTAAAGTAGAGTC[G/A]
AATGATCAACCGAGCTAATTTTTAAAAGAGAAAATAAATTATGTCTACTCTATACAATAAATCGACTCAAAGACATAAAAAAAAAACTATTTTCATCATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.40% | 5.60% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 88.20% | 11.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 92.30% | 7.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 20.80% | 77.10% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0411580078 | C -> T | LOC_Os04g20680-LOC_Os04g20690 | intergenic_region ; MODIFIER | silent_mutation | Average:46.315; most accessible tissue: Zhenshan97 young leaf, score: 60.208 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0411580078 | NA | 9.36E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411580078 | 3.67E-06 | NA | mr1719 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411580078 | 3.34E-06 | NA | mr1789 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411580078 | NA | 1.75E-09 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411580078 | NA | 1.80E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411580078 | NA | 1.22E-11 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |