Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411410586:

Variant ID: vg0411410586 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 11410586
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.62, C: 0.38, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:

TAGGTGATGGGGATGGTTAATATATATTCACCATGGAGAATAAAATGGTTGTAAACCTCTCACCATCAGGGATGACTATGGCGGGGACGGTGAACCATTC[T/C]
CCGTCCCCGCCCCCTGCGGTGACCCGACTTTACTGTGTAGGAGGACTAATTTTAGACTTTTTAGTTGTTTTGGCCCATAATATTGAAGTCCATTTAACAA

Reverse complement sequence

TTGTTAAATGGACTTCAATATTATGGGCCAAAACAACTAAAAAGTCTAAAATTAGTCCTCCTACACAGTAAAGTCGGGTCACCGCAGGGGGCGGGGACGG[A/G]
GAATGGTTCACCGTCCCCGCCATAGTCATCCCTGATGGTGAGAGGTTTACAACCATTTTATTCTCCATGGTGAATATATATTAACCATCCCCATCACCTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.00%	30.00%	5.84%	13.20%	NA
All Indica	2759	38.90%	50.30%	8.63%	2.14%	NA
All Japonica	1512	62.90%	1.20%	0.33%	35.58%	NA
Aus	269	90.30%	0.00%	7.43%	2.23%	NA
Indica I	595	15.60%	76.30%	6.89%	1.18%	NA
Indica II	465	34.80%	44.90%	15.48%	4.73%	NA
Indica III	913	53.70%	41.00%	4.27%	1.10%	NA
Indica Intermediate	786	41.70%	44.80%	10.94%	2.54%	NA
Temperate Japonica	767	93.40%	0.10%	0.00%	6.52%	NA
Tropical Japonica	504	13.70%	0.60%	0.60%	85.12%	NA
Japonica Intermediate	241	68.90%	5.80%	0.83%	24.48%	NA
VI/Aromatic	96	91.70%	0.00%	2.08%	6.25%	NA
Intermediate	90	58.90%	12.20%	12.22%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0411410586	T -> C	LOC_Os04g20390.1	upstream_gene_variant ; 3855.0bp to feature; MODIFIER	silent_mutation	Average:90.166; most accessible tissue: Zhenshan97 panicle, score: 97.923	N	N	N	N
vg0411410586	T -> C	LOC_Os04g20400.1	upstream_gene_variant ; 210.0bp to feature; MODIFIER	silent_mutation	Average:90.166; most accessible tissue: Zhenshan97 panicle, score: 97.923	N	N	N	N
vg0411410586	T -> C	LOC_Os04g20400-LOC_Os04g20410	intergenic_region ; MODIFIER	silent_mutation	Average:90.166; most accessible tissue: Zhenshan97 panicle, score: 97.923	N	N	N	N
vg0411410586	T -> DEL	N	N	silent_mutation	Average:90.166; most accessible tissue: Zhenshan97 panicle, score: 97.923	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0411410586	T	C	-0.02	-0.03	-0.04	-0.01	-0.02	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0411410586	NA	1.09E-06	mr1386	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586	NA	3.64E-10	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586	NA	5.41E-08	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586	NA	1.28E-06	mr1414	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586	NA	7.40E-10	mr1830	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586	4.53E-11	NA	mr1846	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586	3.14E-11	1.67E-18	mr1846	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586	NA	1.55E-06	mr1304_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586	NA	1.83E-06	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586	4.97E-06	NA	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586	NA	6.17E-14	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586	2.73E-10	1.41E-15	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586	1.84E-10	8.67E-30	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251