\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411410586:

Variant ID: vg0411410586 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 11410586
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.62, C: 0.38, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:


TAGGTGATGGGGATGGTTAATATATATTCACCATGGAGAATAAAATGGTTGTAAACCTCTCACCATCAGGGATGACTATGGCGGGGACGGTGAACCATTC[T/C]
CCGTCCCCGCCCCCTGCGGTGACCCGACTTTACTGTGTAGGAGGACTAATTTTAGACTTTTTAGTTGTTTTGGCCCATAATATTGAAGTCCATTTAACAA

Reverse complement sequence

TTGTTAAATGGACTTCAATATTATGGGCCAAAACAACTAAAAAGTCTAAAATTAGTCCTCCTACACAGTAAAGTCGGGTCACCGCAGGGGGCGGGGACGG[A/G]
GAATGGTTCACCGTCCCCGCCATAGTCATCCCTGATGGTGAGAGGTTTACAACCATTTTATTCTCCATGGTGAATATATATTAACCATCCCCATCACCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.00% 30.00% 5.84% 13.20% NA
All Indica  2759 38.90% 50.30% 8.63% 2.14% NA
All Japonica  1512 62.90% 1.20% 0.33% 35.58% NA
Aus  269 90.30% 0.00% 7.43% 2.23% NA
Indica I  595 15.60% 76.30% 6.89% 1.18% NA
Indica II  465 34.80% 44.90% 15.48% 4.73% NA
Indica III  913 53.70% 41.00% 4.27% 1.10% NA
Indica Intermediate  786 41.70% 44.80% 10.94% 2.54% NA
Temperate Japonica  767 93.40% 0.10% 0.00% 6.52% NA
Tropical Japonica  504 13.70% 0.60% 0.60% 85.12% NA
Japonica Intermediate  241 68.90% 5.80% 0.83% 24.48% NA
VI/Aromatic  96 91.70% 0.00% 2.08% 6.25% NA
Intermediate  90 58.90% 12.20% 12.22% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0411410586 T -> C LOC_Os04g20390.1 upstream_gene_variant ; 3855.0bp to feature; MODIFIER silent_mutation Average:90.166; most accessible tissue: Zhenshan97 panicle, score: 97.923 N N N N
vg0411410586 T -> C LOC_Os04g20400.1 upstream_gene_variant ; 210.0bp to feature; MODIFIER silent_mutation Average:90.166; most accessible tissue: Zhenshan97 panicle, score: 97.923 N N N N
vg0411410586 T -> C LOC_Os04g20400-LOC_Os04g20410 intergenic_region ; MODIFIER silent_mutation Average:90.166; most accessible tissue: Zhenshan97 panicle, score: 97.923 N N N N
vg0411410586 T -> DEL N N silent_mutation Average:90.166; most accessible tissue: Zhenshan97 panicle, score: 97.923 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0411410586 T C -0.02 -0.03 -0.04 -0.01 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0411410586 NA 1.09E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586 NA 3.64E-10 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586 NA 5.41E-08 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586 NA 1.28E-06 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586 NA 7.40E-10 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586 4.53E-11 NA mr1846 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586 3.14E-11 1.67E-18 mr1846 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586 NA 1.55E-06 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586 NA 1.83E-06 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586 4.97E-06 NA mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586 NA 6.17E-14 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586 2.73E-10 1.41E-15 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411410586 1.84E-10 8.67E-30 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251