\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411407679:

Variant ID: vg0411407679 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 11407679
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCGGTAGGATTGGAGCCATGGTTTCGCTTAGGCCGAGGTTAGTTCTAAACTTTTTCTTTAAACTTTTAACTTTTTCATCACATCAAAACTTTTCTACA[C/T]
ACATAAACTTCGAACTTTTTCGTCACAACGTTCCAATTTCAATCAAATTTTCAATTTTGGCGTGAACTAAACACACCCTTAATAAGCGAAACGGCATATT

Reverse complement sequence

AATATGCCGTTTCGCTTATTAAGGGTGTGTTTAGTTCACGCCAAAATTGAAAATTTGATTGAAATTGGAACGTTGTGACGAAAAAGTTCGAAGTTTATGT[G/A]
TGTAGAAAAGTTTTGATGTGATGAAAAAGTTAAAAGTTTAAAGAAAAAGTTTAGAACTAACCTCGGCCTAAGCGAAACCATGGCTCCAATCCTACCGGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.50% 34.60% 0.19% 11.70% NA
All Indica  2759 52.00% 47.60% 0.04% 0.36% NA
All Japonica  1512 63.90% 0.90% 0.46% 34.79% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 77.00% 22.90% 0.17% 0.00% NA
Indica II  465 47.30% 51.60% 0.00% 1.08% NA
Indica III  913 41.90% 57.80% 0.00% 0.22% NA
Indica Intermediate  786 47.60% 52.00% 0.00% 0.38% NA
Temperate Japonica  767 93.40% 0.30% 0.00% 6.39% NA
Tropical Japonica  504 14.10% 1.40% 1.19% 83.33% NA
Japonica Intermediate  241 74.30% 1.70% 0.41% 23.65% NA
VI/Aromatic  96 81.20% 12.50% 0.00% 6.25% NA
Intermediate  90 52.20% 34.40% 1.11% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0411407679 C -> DEL N N silent_mutation Average:85.856; most accessible tissue: Callus, score: 91.539 N N N N
vg0411407679 C -> T LOC_Os04g20390.1 upstream_gene_variant ; 948.0bp to feature; MODIFIER silent_mutation Average:85.856; most accessible tissue: Callus, score: 91.539 N N N N
vg0411407679 C -> T LOC_Os04g20380.1 downstream_gene_variant ; 4738.0bp to feature; MODIFIER silent_mutation Average:85.856; most accessible tissue: Callus, score: 91.539 N N N N
vg0411407679 C -> T LOC_Os04g20400.1 downstream_gene_variant ; 844.0bp to feature; MODIFIER silent_mutation Average:85.856; most accessible tissue: Callus, score: 91.539 N N N N
vg0411407679 C -> T LOC_Os04g20390-LOC_Os04g20400 intergenic_region ; MODIFIER silent_mutation Average:85.856; most accessible tissue: Callus, score: 91.539 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0411407679 C T -0.03 -0.03 -0.03 -0.03 -0.05 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0411407679 NA 2.20E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411407679 NA 3.82E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411407679 NA 1.05E-07 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411407679 NA 2.17E-14 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411407679 NA 2.49E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411407679 NA 9.31E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411407679 NA 1.16E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411407679 NA 6.50E-07 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411407679 NA 4.67E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411407679 NA 1.48E-19 mr1830 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411407679 NA 1.63E-10 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411407679 1.62E-10 5.15E-29 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411407679 3.22E-09 1.21E-16 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411407679 NA 7.21E-06 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411407679 NA 2.54E-06 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411407679 NA 1.66E-08 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411407679 NA 8.00E-06 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411407679 2.85E-06 3.53E-19 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411407679 5.35E-06 5.16E-15 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411407679 1.45E-12 6.16E-51 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411407679 1.10E-11 2.06E-31 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251