\
| Variant ID: vg0411377590 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 11377590 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 78. )
AAAAGGGCCCTTGCCCTGTTTGCGCCACAGGGCTGATGCGAATGCGAGGGAGGCGTCGGCGTCGCTCGCGGCTCGGGTGCGACGTGGTGCTTTGCGTGCG[G/A]
CAGCGGCGCACGGCAGGCTCCGGCTTGGAGGGCGGGCGGTGGTCAAGAGCGGGACCGGAGGCGACGTGATGGGACGGAGTCGTTTGCCCGGCGTGGTGTG
CACACCACGCCGGGCAAACGACTCCGTCCCATCACGTCGCCTCCGGTCCCGCTCTTGACCACCGCCCGCCCTCCAAGCCGGAGCCTGCCGTGCGCCGCTG[C/T]
CGCACGCAAAGCACCACGTCGCACCCGAGCCGCGAGCGACGCCGACGCCTCCCTCGCATTCGCATCAGCCCTGTGGCGCAAACAGGGCAAGGGCCCTTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.90% | 28.50% | 0.55% | 5.01% | NA |
| All Indica | 2759 | 53.10% | 42.80% | 0.87% | 3.23% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.07% | NA |
| Aus | 269 | 1.50% | 48.00% | 0.74% | 49.81% | NA |
| Indica I | 595 | 78.00% | 21.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 48.80% | 50.30% | 0.65% | 0.22% | NA |
| Indica III | 913 | 42.30% | 49.50% | 1.42% | 6.79% | NA |
| Indica Intermediate | 786 | 49.50% | 46.30% | 0.89% | 3.31% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 0.80% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 3.10% | 0.00% | 10.42% | NA |
| Intermediate | 90 | 67.80% | 28.90% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0411377590 | G -> DEL | N | N | silent_mutation | Average:75.022; most accessible tissue: Zhenshan97 panicle, score: 90.268 | N | N | N | N |
| vg0411377590 | G -> A | LOC_Os04g20330.1 | upstream_gene_variant ; 273.0bp to feature; MODIFIER | silent_mutation | Average:75.022; most accessible tissue: Zhenshan97 panicle, score: 90.268 | N | N | N | N |
| vg0411377590 | G -> A | LOC_Os04g20340.1 | upstream_gene_variant ; 4342.0bp to feature; MODIFIER | silent_mutation | Average:75.022; most accessible tissue: Zhenshan97 panicle, score: 90.268 | N | N | N | N |
| vg0411377590 | G -> A | LOC_Os04g20330-LOC_Os04g20340 | intergenic_region ; MODIFIER | silent_mutation | Average:75.022; most accessible tissue: Zhenshan97 panicle, score: 90.268 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0411377590 | NA | 4.74E-06 | mr1373 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411377590 | NA | 1.27E-12 | mr1386 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411377590 | NA | 8.75E-09 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411377590 | NA | 6.08E-07 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411377590 | NA | 3.21E-06 | mr1414 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411377590 | NA | 9.55E-18 | mr1830 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411377590 | NA | 2.77E-09 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411377590 | NA | 9.19E-06 | mr1833 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411377590 | 7.92E-10 | 8.01E-28 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411377590 | 7.57E-09 | 3.72E-16 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411377590 | NA | 4.44E-06 | mr1304_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411377590 | 2.95E-06 | 1.51E-18 | mr1830_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411377590 | 4.06E-06 | 1.74E-14 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411377590 | 6.54E-14 | 1.35E-52 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411377590 | 4.93E-13 | 1.39E-33 | mr1846_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |