\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411377590:

Variant ID: vg0411377590 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 11377590
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAGGGCCCTTGCCCTGTTTGCGCCACAGGGCTGATGCGAATGCGAGGGAGGCGTCGGCGTCGCTCGCGGCTCGGGTGCGACGTGGTGCTTTGCGTGCG[G/A]
CAGCGGCGCACGGCAGGCTCCGGCTTGGAGGGCGGGCGGTGGTCAAGAGCGGGACCGGAGGCGACGTGATGGGACGGAGTCGTTTGCCCGGCGTGGTGTG

Reverse complement sequence

CACACCACGCCGGGCAAACGACTCCGTCCCATCACGTCGCCTCCGGTCCCGCTCTTGACCACCGCCCGCCCTCCAAGCCGGAGCCTGCCGTGCGCCGCTG[C/T]
CGCACGCAAAGCACCACGTCGCACCCGAGCCGCGAGCGACGCCGACGCCTCCCTCGCATTCGCATCAGCCCTGTGGCGCAAACAGGGCAAGGGCCCTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.90% 28.50% 0.55% 5.01% NA
All Indica  2759 53.10% 42.80% 0.87% 3.23% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.07% NA
Aus  269 1.50% 48.00% 0.74% 49.81% NA
Indica I  595 78.00% 21.80% 0.17% 0.00% NA
Indica II  465 48.80% 50.30% 0.65% 0.22% NA
Indica III  913 42.30% 49.50% 1.42% 6.79% NA
Indica Intermediate  786 49.50% 46.30% 0.89% 3.31% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 0.80% 0.00% 0.20% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 3.10% 0.00% 10.42% NA
Intermediate  90 67.80% 28.90% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0411377590 G -> DEL N N silent_mutation Average:75.022; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0411377590 G -> A LOC_Os04g20330.1 upstream_gene_variant ; 273.0bp to feature; MODIFIER silent_mutation Average:75.022; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0411377590 G -> A LOC_Os04g20340.1 upstream_gene_variant ; 4342.0bp to feature; MODIFIER silent_mutation Average:75.022; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N
vg0411377590 G -> A LOC_Os04g20330-LOC_Os04g20340 intergenic_region ; MODIFIER silent_mutation Average:75.022; most accessible tissue: Zhenshan97 panicle, score: 90.268 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0411377590 NA 4.74E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411377590 NA 1.27E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411377590 NA 8.75E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411377590 NA 6.08E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411377590 NA 3.21E-06 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411377590 NA 9.55E-18 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411377590 NA 2.77E-09 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411377590 NA 9.19E-06 mr1833 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411377590 7.92E-10 8.01E-28 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411377590 7.57E-09 3.72E-16 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411377590 NA 4.44E-06 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411377590 2.95E-06 1.51E-18 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411377590 4.06E-06 1.74E-14 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411377590 6.54E-14 1.35E-52 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411377590 4.93E-13 1.39E-33 mr1846_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251