\
| Variant ID: vg0411353933 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 11353933 |
| Reference Allele: GAATTAAA | Alternative Allele: AAATTAAA,G |
| Primary Allele: GAATTAAA | Secondary Allele: AAATTAAA |
Inferred Ancestral Allele: Not determined.
GGTATATTTGGATAAAAAGAACATAAATTGTTTATAGCAAATTTTGTTACCCACATTTGAAGAATCAAGTCAACAATTTTCTGGACACCACGAAGACCAT[GAATTAAA/AAATTAAA,G]
AAGAAGAAAGTGTCTCGACAAACATTTTCAACCCAAAGAACTATACACCATGCCAATCATGTTGAAGGCAAGGTTATCAATGTATAGCAAAAATAGAGAT
ATCTCTATTTTTGCTATACATTGATAACCTTGCCTTCAACATGATTGGCATGGTGTATAGTTCTTTGGGTTGAAAATGTTTGTCGAGACACTTTCTTCTT[TTTAATTC/TTTAATTT,C]
ATGGTCTTCGTGGTGTCCAGAAAATTGTTGACTTGATTCTTCAAATGTGGGTAACAAAATTTGCTATAAACAATTTATGTTCTTTTTATCCAAATATACC
| Populations | Population Size | Frequency of GAATTAAA(primary allele) | Frequency of AAATTAAA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.90% | 4.90% | 4.78% | 35.23% | G: 0.17% |
| All Indica | 2759 | 34.00% | 8.20% | 5.94% | 51.61% | G: 0.25% |
| All Japonica | 1512 | 99.30% | 0.10% | 0.13% | 0.53% | NA |
| Aus | 269 | 6.70% | 0.00% | 18.59% | 74.35% | G: 0.37% |
| Indica I | 595 | 29.90% | 0.50% | 3.53% | 65.55% | G: 0.50% |
| Indica II | 465 | 17.00% | 25.60% | 10.97% | 46.45% | NA |
| Indica III | 913 | 41.70% | 3.80% | 4.93% | 49.18% | G: 0.33% |
| Indica Intermediate | 786 | 38.00% | 8.90% | 5.98% | 46.95% | G: 0.13% |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.00% | 0.00% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 86.50% | 0.00% | 4.17% | 9.38% | NA |
| Intermediate | 90 | 63.30% | 3.30% | 6.67% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0411353933 | GAATTAAA -> DEL | N | N | silent_mutation | Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028 | N | N | N | N |
| vg0411353933 | GAATTAAA -> G | LOC_Os04g20290.1 | upstream_gene_variant ; 4585.0bp to feature; MODIFIER | silent_mutation | Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028 | N | N | N | N |
| vg0411353933 | GAATTAAA -> G | LOC_Os04g20300.1 | upstream_gene_variant ; 2726.0bp to feature; MODIFIER | silent_mutation | Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028 | N | N | N | N |
| vg0411353933 | GAATTAAA -> G | LOC_Os04g20310.1 | upstream_gene_variant ; 4859.0bp to feature; MODIFIER | silent_mutation | Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028 | N | N | N | N |
| vg0411353933 | GAATTAAA -> G | LOC_Os04g20290-LOC_Os04g20300 | intergenic_region ; MODIFIER | silent_mutation | Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028 | N | N | N | N |
| vg0411353933 | GAATTAAA -> AAATTAAA | LOC_Os04g20290.1 | upstream_gene_variant ; 4584.0bp to feature; MODIFIER | silent_mutation | Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028 | N | N | N | N |
| vg0411353933 | GAATTAAA -> AAATTAAA | LOC_Os04g20300.1 | upstream_gene_variant ; 2727.0bp to feature; MODIFIER | silent_mutation | Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028 | N | N | N | N |
| vg0411353933 | GAATTAAA -> AAATTAAA | LOC_Os04g20310.1 | upstream_gene_variant ; 4860.0bp to feature; MODIFIER | silent_mutation | Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028 | N | N | N | N |
| vg0411353933 | GAATTAAA -> AAATTAAA | LOC_Os04g20290-LOC_Os04g20300 | intergenic_region ; MODIFIER | silent_mutation | Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0411353933 | NA | 3.36E-07 | mr1024_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411353933 | 4.73E-06 | NA | mr1584_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411353933 | 4.84E-07 | 4.84E-07 | mr1584_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |