\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411353933:

Variant ID: vg0411353933 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 11353933
Reference Allele: GAATTAAAAlternative Allele: AAATTAAA,G
Primary Allele: GAATTAAASecondary Allele: AAATTAAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTATATTTGGATAAAAAGAACATAAATTGTTTATAGCAAATTTTGTTACCCACATTTGAAGAATCAAGTCAACAATTTTCTGGACACCACGAAGACCAT[GAATTAAA/AAATTAAA,G]
AAGAAGAAAGTGTCTCGACAAACATTTTCAACCCAAAGAACTATACACCATGCCAATCATGTTGAAGGCAAGGTTATCAATGTATAGCAAAAATAGAGAT

Reverse complement sequence

ATCTCTATTTTTGCTATACATTGATAACCTTGCCTTCAACATGATTGGCATGGTGTATAGTTCTTTGGGTTGAAAATGTTTGTCGAGACACTTTCTTCTT[TTTAATTC/TTTAATTT,C]
ATGGTCTTCGTGGTGTCCAGAAAATTGTTGACTTGATTCTTCAAATGTGGGTAACAAAATTTGCTATAAACAATTTATGTTCTTTTTATCCAAATATACC

Allele Frequencies:

Populations Population SizeFrequency of GAATTAAA(primary allele) Frequency of AAATTAAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.90% 4.90% 4.78% 35.23% G: 0.17%
All Indica  2759 34.00% 8.20% 5.94% 51.61% G: 0.25%
All Japonica  1512 99.30% 0.10% 0.13% 0.53% NA
Aus  269 6.70% 0.00% 18.59% 74.35% G: 0.37%
Indica I  595 29.90% 0.50% 3.53% 65.55% G: 0.50%
Indica II  465 17.00% 25.60% 10.97% 46.45% NA
Indica III  913 41.70% 3.80% 4.93% 49.18% G: 0.33%
Indica Intermediate  786 38.00% 8.90% 5.98% 46.95% G: 0.13%
Temperate Japonica  767 99.70% 0.10% 0.00% 0.13% NA
Tropical Japonica  504 99.00% 0.00% 0.00% 0.99% NA
Japonica Intermediate  241 98.30% 0.00% 0.83% 0.83% NA
VI/Aromatic  96 86.50% 0.00% 4.17% 9.38% NA
Intermediate  90 63.30% 3.30% 6.67% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0411353933 GAATTAAA -> DEL N N silent_mutation Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0411353933 GAATTAAA -> G LOC_Os04g20290.1 upstream_gene_variant ; 4585.0bp to feature; MODIFIER silent_mutation Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0411353933 GAATTAAA -> G LOC_Os04g20300.1 upstream_gene_variant ; 2726.0bp to feature; MODIFIER silent_mutation Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0411353933 GAATTAAA -> G LOC_Os04g20310.1 upstream_gene_variant ; 4859.0bp to feature; MODIFIER silent_mutation Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0411353933 GAATTAAA -> G LOC_Os04g20290-LOC_Os04g20300 intergenic_region ; MODIFIER silent_mutation Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0411353933 GAATTAAA -> AAATTAAA LOC_Os04g20290.1 upstream_gene_variant ; 4584.0bp to feature; MODIFIER silent_mutation Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0411353933 GAATTAAA -> AAATTAAA LOC_Os04g20300.1 upstream_gene_variant ; 2727.0bp to feature; MODIFIER silent_mutation Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0411353933 GAATTAAA -> AAATTAAA LOC_Os04g20310.1 upstream_gene_variant ; 4860.0bp to feature; MODIFIER silent_mutation Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N
vg0411353933 GAATTAAA -> AAATTAAA LOC_Os04g20290-LOC_Os04g20300 intergenic_region ; MODIFIER silent_mutation Average:37.912; most accessible tissue: Minghui63 flag leaf, score: 72.028 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0411353933 NA 3.36E-07 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411353933 4.73E-06 NA mr1584_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411353933 4.84E-07 4.84E-07 mr1584_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251