Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0411353830:

Variant ID: vg0411353830 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 11353830
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTCTCCATGGTTTTCGTGACCATACAAAAACTTGGAGATTCATGGCTAGAGCTAGAGATTTGTACTCCCGACAAGCACAAGGATTTTGAATGGATATC[G/A]
GTGGTATATTTGGATAAAAAGAACATAAATTGTTTATAGCAAATTTTGTTACCCACATTTGAAGAATCAAGTCAACAATTTTCTGGACACCACGAAGACC

Reverse complement sequence

GGTCTTCGTGGTGTCCAGAAAATTGTTGACTTGATTCTTCAAATGTGGGTAACAAAATTTGCTATAAACAATTTATGTTCTTTTTATCCAAATATACCAC[C/T]
GATATCCATTCAAAATCCTTGTGCTTGTCGGGAGTACAAATCTCTAGCTCTAGCCATGAATCTCCAAGTTTTTGTATGGTCACGAAAACCATGGAGAGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.30%	29.20%	5.86%	29.64%	NA
All Indica	2759	1.60%	46.80%	8.81%	42.77%	NA
All Japonica	1512	99.10%	0.40%	0.20%	0.33%	NA
Aus	269	0.00%	20.40%	6.32%	73.23%	NA
Indica I	595	1.00%	34.60%	3.36%	61.01%	NA
Indica II	465	3.20%	71.80%	6.88%	18.06%	NA
Indica III	913	0.80%	37.60%	12.71%	48.96%	NA
Indica Intermediate	786	2.00%	52.00%	9.54%	36.39%	NA
Temperate Japonica	767	99.60%	0.10%	0.00%	0.26%	NA
Tropical Japonica	504	98.80%	0.60%	0.20%	0.40%	NA
Japonica Intermediate	241	97.90%	0.80%	0.83%	0.41%	NA
VI/Aromatic	96	86.50%	1.00%	2.08%	10.42%	NA
Intermediate	90	48.90%	27.80%	13.33%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0411353830	G -> DEL	N	N	silent_mutation	Average:28.436; most accessible tissue: Minghui63 flag leaf, score: 48.324	N	N	N	N
vg0411353830	G -> A	LOC_Os04g20290.1	upstream_gene_variant ; 4481.0bp to feature; MODIFIER	silent_mutation	Average:28.436; most accessible tissue: Minghui63 flag leaf, score: 48.324	N	N	N	N
vg0411353830	G -> A	LOC_Os04g20300.1	upstream_gene_variant ; 2830.0bp to feature; MODIFIER	silent_mutation	Average:28.436; most accessible tissue: Minghui63 flag leaf, score: 48.324	N	N	N	N
vg0411353830	G -> A	LOC_Os04g20310.1	upstream_gene_variant ; 4963.0bp to feature; MODIFIER	silent_mutation	Average:28.436; most accessible tissue: Minghui63 flag leaf, score: 48.324	N	N	N	N
vg0411353830	G -> A	LOC_Os04g20290-LOC_Os04g20300	intergenic_region ; MODIFIER	silent_mutation	Average:28.436; most accessible tissue: Minghui63 flag leaf, score: 48.324	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0411353830	NA	1.05E-11	mr1322_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411353830	NA	1.92E-18	mr1324_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411353830	NA	1.01E-14	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411353830	NA	6.11E-16	mr1326_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411353830	NA	1.56E-16	mr1333_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411353830	NA	1.26E-07	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411353830	NA	2.86E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251