\
| Variant ID: vg0411353830 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 11353830 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 69. )
ATCTCTCCATGGTTTTCGTGACCATACAAAAACTTGGAGATTCATGGCTAGAGCTAGAGATTTGTACTCCCGACAAGCACAAGGATTTTGAATGGATATC[G/A]
GTGGTATATTTGGATAAAAAGAACATAAATTGTTTATAGCAAATTTTGTTACCCACATTTGAAGAATCAAGTCAACAATTTTCTGGACACCACGAAGACC
GGTCTTCGTGGTGTCCAGAAAATTGTTGACTTGATTCTTCAAATGTGGGTAACAAAATTTGCTATAAACAATTTATGTTCTTTTTATCCAAATATACCAC[C/T]
GATATCCATTCAAAATCCTTGTGCTTGTCGGGAGTACAAATCTCTAGCTCTAGCCATGAATCTCCAAGTTTTTGTATGGTCACGAAAACCATGGAGAGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.30% | 29.20% | 5.86% | 29.64% | NA |
| All Indica | 2759 | 1.60% | 46.80% | 8.81% | 42.77% | NA |
| All Japonica | 1512 | 99.10% | 0.40% | 0.20% | 0.33% | NA |
| Aus | 269 | 0.00% | 20.40% | 6.32% | 73.23% | NA |
| Indica I | 595 | 1.00% | 34.60% | 3.36% | 61.01% | NA |
| Indica II | 465 | 3.20% | 71.80% | 6.88% | 18.06% | NA |
| Indica III | 913 | 0.80% | 37.60% | 12.71% | 48.96% | NA |
| Indica Intermediate | 786 | 2.00% | 52.00% | 9.54% | 36.39% | NA |
| Temperate Japonica | 767 | 99.60% | 0.10% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 98.80% | 0.60% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.80% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 86.50% | 1.00% | 2.08% | 10.42% | NA |
| Intermediate | 90 | 48.90% | 27.80% | 13.33% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0411353830 | G -> DEL | N | N | silent_mutation | Average:28.436; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
| vg0411353830 | G -> A | LOC_Os04g20290.1 | upstream_gene_variant ; 4481.0bp to feature; MODIFIER | silent_mutation | Average:28.436; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
| vg0411353830 | G -> A | LOC_Os04g20300.1 | upstream_gene_variant ; 2830.0bp to feature; MODIFIER | silent_mutation | Average:28.436; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
| vg0411353830 | G -> A | LOC_Os04g20310.1 | upstream_gene_variant ; 4963.0bp to feature; MODIFIER | silent_mutation | Average:28.436; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
| vg0411353830 | G -> A | LOC_Os04g20290-LOC_Os04g20300 | intergenic_region ; MODIFIER | silent_mutation | Average:28.436; most accessible tissue: Minghui63 flag leaf, score: 48.324 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0411353830 | NA | 1.05E-11 | mr1322_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411353830 | NA | 1.92E-18 | mr1324_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411353830 | NA | 1.01E-14 | mr1325_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411353830 | NA | 6.11E-16 | mr1326_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411353830 | NA | 1.56E-16 | mr1333_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411353830 | NA | 1.26E-07 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411353830 | NA | 2.86E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |