\
| Variant ID: vg0411210100 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 11210100 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGCCATAACGACTGAGTTGGGGTGTTCCGATCTTCCAGTGCCAAGGTTCGCGCGTAAAGCACTGGGTTCTCCATCTTCAGGATGGTGTCCTTCTGGGAC[C/T]
ATCTCAACTTCAGGTTGAGTTGCCTCTTCTGGGGCTTTCTCAACTTCAGGTTGAGCTTCTTCAACTGATTCTTTGAGTGGAACAAGTGGCTCAGGTCCTT
AAGGACCTGAGCCACTTGTTCCACTCAAAGAATCAGTTGAAGAAGCTCAACCTGAAGTTGAGAAAGCCCCAGAAGAGGCAACTCAACCTGAAGTTGAGAT[G/A]
GTCCCAGAAGGACACCATCCTGAAGATGGAGAACCCAGTGCTTTACGCGCGAACCTTGGCACTGGAAGATCGGAACACCCCAACTCAGTCGTTATGGCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.50% | 14.70% | 0.38% | 0.42% | NA |
| All Indica | 2759 | 98.30% | 0.50% | 0.47% | 0.69% | NA |
| All Japonica | 1512 | 61.80% | 37.90% | 0.26% | 0.07% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.00% | 0.34% | 0.17% | NA |
| Indica II | 465 | 94.20% | 1.10% | 1.51% | 3.23% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.20% | 0.90% | 0.51% | 0.38% | NA |
| Temperate Japonica | 767 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.40% | 94.00% | 0.40% | 0.20% | NA |
| Japonica Intermediate | 241 | 69.70% | 29.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 14.60% | 85.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 26.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0411210100 | C -> DEL | LOC_Os04g20120.1 | N | frameshift_variant | Average:11.209; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0411210100 | C -> T | LOC_Os04g20120.1 | missense_variant ; p.Met692Ile; MODERATE | nonsynonymous_codon ; M692I | Average:11.209; most accessible tissue: Minghui63 panicle, score: 20.733 | unknown | unknown | TOLERATED | 0.55 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0411210100 | NA | 2.57E-07 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411210100 | NA | 2.31E-12 | mr1330 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411210100 | NA | 3.87E-13 | mr1454 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411210100 | NA | 9.72E-09 | mr1715 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411210100 | NA | 4.44E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411210100 | NA | 2.26E-11 | mr1864 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411210100 | NA | 1.76E-11 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411210100 | NA | 2.89E-09 | mr1398_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411210100 | NA | 2.70E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411210100 | NA | 7.69E-06 | mr1668_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |