\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411150618:

Variant ID: vg0411150618 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 11150618
Reference Allele: GAlternative Allele: A,GACCGGGGAAAAACAGCACACCACGTGGCGCTGACGTGGCGCCGACGT,GGGATTA
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATTTATTGCGCAATAAATAAACCCTGGAGAGAGAAGGGGCGGCACCGACACGCGGGCCCCACATGGCAGTGGCTCGGGGTTGCGGTCCGTGGTGGACCG[G/A,GACCGGGGAAAAACAGCACACCACGTGGCGCTGACGTGGCGCCGACGT,GGGATTA]
GTCCACGAACCGGGGAAAAACAGCACACCACATGGCGCTGACGTGGCGGCCACATGGCAGCCACGTGGGTGGCGAGGCGGACGGCCCCGATCTACCCCCG

Reverse complement sequence

CGGGGGTAGATCGGGGCCGTCCGCCTCGCCACCCACGTGGCTGCCATGTGGCCGCCACGTCAGCGCCATGTGGTGTGCTGTTTTTCCCCGGTTCGTGGAC[C/T,ACGTCGGCGCCACGTCAGCGCCACGTGGTGTGCTGTTTTTCCCCGGTC,TAATCCC]
CGGTCCACCACGGACCGCAACCCCGAGCCACTGCCATGTGGGGCCCGCGTGTCGGTGCCGCCCCTTCTCTCTCCAGGGTTTATTTATTGCGCAATAAATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.00% 7.60% 6.37% 0.00% GACCGGGGAAAAACAGCACACCACGTGGCGCTGACGTGGCGCCGACGT: 0.02%
All Indica  2759 82.70% 8.70% 8.52% 0.00% GACCGGGGAAAAACAGCACACCACGTGGCGCTGACGTGGCGCCGACGT: 0.04%
All Japonica  1512 99.70% 0.20% 0.13% 0.00% NA
Aus  269 42.00% 37.20% 20.82% 0.00% NA
Indica I  595 95.00% 2.00% 2.86% 0.00% GACCGGGGAAAAACAGCACACCACGTGGCGCTGACGTGGCGCCGACGT: 0.17%
Indica II  465 92.30% 2.60% 5.16% 0.00% NA
Indica III  913 68.50% 16.90% 14.68% 0.00% NA
Indica Intermediate  786 84.50% 7.90% 7.63% 0.00% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 7.30% 2.08% 0.00% NA
Intermediate  90 83.30% 10.00% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0411150618 G -> GACCGGGGAAAAACAGCACACCACGTGGCG CTGACGTGGCGCCGACGT LOC_Os04g20000.1 upstream_gene_variant ; 31.0bp to feature; MODIFIER silent_mutation Average:83.25; most accessible tissue: Minghui63 young leaf, score: 93.647 N N N N
vg0411150618 G -> GACCGGGGAAAAACAGCACACCACGTGGCG CTGACGTGGCGCCGACGT LOC_Os04g20010.1 upstream_gene_variant ; 2229.0bp to feature; MODIFIER silent_mutation Average:83.25; most accessible tissue: Minghui63 young leaf, score: 93.647 N N N N
vg0411150618 G -> GACCGGGGAAAAACAGCACACCACGTGGCG CTGACGTGGCGCCGACGT LOC_Os04g19990.1 downstream_gene_variant ; 3122.0bp to feature; MODIFIER silent_mutation Average:83.25; most accessible tissue: Minghui63 young leaf, score: 93.647 N N N N
vg0411150618 G -> GACCGGGGAAAAACAGCACACCACGTGGCG CTGACGTGGCGCCGACGT LOC_Os04g19990-LOC_Os04g20000 intergenic_region ; MODIFIER silent_mutation Average:83.25; most accessible tissue: Minghui63 young leaf, score: 93.647 N N N N
vg0411150618 G -> A LOC_Os04g20000.1 upstream_gene_variant ; 32.0bp to feature; MODIFIER silent_mutation Average:83.25; most accessible tissue: Minghui63 young leaf, score: 93.647 N N N N
vg0411150618 G -> A LOC_Os04g20010.1 upstream_gene_variant ; 2230.0bp to feature; MODIFIER silent_mutation Average:83.25; most accessible tissue: Minghui63 young leaf, score: 93.647 N N N N
vg0411150618 G -> A LOC_Os04g19990.1 downstream_gene_variant ; 3121.0bp to feature; MODIFIER silent_mutation Average:83.25; most accessible tissue: Minghui63 young leaf, score: 93.647 N N N N
vg0411150618 G -> A LOC_Os04g19990-LOC_Os04g20000 intergenic_region ; MODIFIER silent_mutation Average:83.25; most accessible tissue: Minghui63 young leaf, score: 93.647 N N N N
vg0411150618 G -> GGGATTA LOC_Os04g20000.1 upstream_gene_variant ; 31.0bp to feature; MODIFIER N Average:83.25; most accessible tissue: Minghui63 young leaf, score: 93.647 N N N N
vg0411150618 G -> GGGATTA LOC_Os04g20010.1 upstream_gene_variant ; 2229.0bp to feature; MODIFIER N Average:83.25; most accessible tissue: Minghui63 young leaf, score: 93.647 N N N N
vg0411150618 G -> GGGATTA LOC_Os04g19990.1 downstream_gene_variant ; 3122.0bp to feature; MODIFIER N Average:83.25; most accessible tissue: Minghui63 young leaf, score: 93.647 N N N N
vg0411150618 G -> GGGATTA LOC_Os04g19990-LOC_Os04g20000 intergenic_region ; MODIFIER N Average:83.25; most accessible tissue: Minghui63 young leaf, score: 93.647 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0411150618 G A -0.01 -0.01 -0.01 -0.02 -0.01 -0.01
vg0411150618 G GACCG* 0.07 0.04 0.03 0.09 0.03 0.01
vg0411150618 G GGGAT* -0.05 -0.11 -0.07 -0.07 -0.08 -0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0411150618 NA 6.35E-13 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411150618 NA 2.49E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411150618 NA 2.28E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411150618 NA 6.72E-06 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411150618 NA 1.25E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411150618 NA 2.08E-17 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411150618 NA 1.12E-08 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411150618 8.45E-12 1.75E-30 mr1846 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411150618 1.04E-09 2.00E-17 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411150618 NA 3.41E-06 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411150618 NA 1.05E-06 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411150618 5.39E-06 6.79E-19 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411150618 7.20E-06 1.12E-14 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411150618 5.81E-12 8.08E-50 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411150618 5.97E-12 6.79E-32 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251