\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411120101:

Variant ID: vg0411120101 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 11120101
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.52, A: 0.47, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AAATCATGTCAAGTTAGTATGCAATTTTTTTAAAGAGATTTCTGATACGGCTCCTTCTATATTTCCAAAAGCGAACGGATTTAAAACCCAACTCAAATAC[G/A]
GATCTGTATTTCCAAAAGCAAACGAACTTAAAACCTTCTCGTATACGGATCGCCTACCAAAACACCGGTAAAAACATCTTCAATTTTTATAATAGTAGAG

Reverse complement sequence

CTCTACTATTATAAAAATTGAAGATGTTTTTACCGGTGTTTTGGTAGGCGATCCGTATACGAGAAGGTTTTAAGTTCGTTTGCTTTTGGAAATACAGATC[C/T]
GTATTTGAGTTGGGTTTTAAATCCGTTCGCTTTTGGAAATATAGAAGGAGCCGTATCAGAAATCTCTTTAAAAAAATTGCATACTAACTTGACATGATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.60% 31.60% 1.80% 0.00% NA
All Indica  2759 98.30% 1.40% 0.22% 0.00% NA
All Japonica  1512 7.10% 87.80% 5.09% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 96.30% 3.20% 0.43% 0.00% NA
Indica III  913 99.20% 0.50% 0.22% 0.00% NA
Indica Intermediate  786 97.60% 2.20% 0.25% 0.00% NA
Temperate Japonica  767 11.00% 81.10% 7.95% 0.00% NA
Tropical Japonica  504 3.00% 97.00% 0.00% 0.00% NA
Japonica Intermediate  241 3.70% 89.60% 6.64% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 51.10% 46.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0411120101 G -> A LOC_Os04g19950.1 upstream_gene_variant ; 1824.0bp to feature; MODIFIER silent_mutation Average:37.303; most accessible tissue: Minghui63 root, score: 56.226 N N N N
vg0411120101 G -> A LOC_Os04g19940.1 downstream_gene_variant ; 2626.0bp to feature; MODIFIER silent_mutation Average:37.303; most accessible tissue: Minghui63 root, score: 56.226 N N N N
vg0411120101 G -> A LOC_Os04g19940-LOC_Os04g19950 intergenic_region ; MODIFIER silent_mutation Average:37.303; most accessible tissue: Minghui63 root, score: 56.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0411120101 2.21E-08 8.51E-19 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411120101 3.30E-06 2.05E-08 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411120101 5.56E-07 1.03E-22 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411120101 NA 4.99E-10 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411120101 NA 8.48E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411120101 1.87E-07 6.71E-16 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411120101 NA 4.71E-07 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411120101 NA 5.10E-26 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411120101 1.64E-07 1.67E-18 mr1035_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411120101 NA 6.79E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411120101 NA 8.08E-23 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411120101 NA 1.11E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411120101 NA 4.52E-17 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411120101 1.31E-08 5.04E-39 mr1631_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411120101 NA 4.33E-10 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251