Search for Variation information by Variation ID:
Detailed information for vg0411116007:
| Variant ID: vg0411116007 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 11116007 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, A: 0.24, others allele: 0.00, population size: 222. )
Flanking Sequence (100 bp) in Reference Genome:
TTCTTACTTGCGCACATGGGGTGCTTGGCGAAAGTCAATGTACCAATAACGAAGAAGCGCAAACTTGGACCTAAGACTATGGACTGTGTCATTCTGGGAT[A/T]
TGCTTATCACAGCATTGCCTATAGATTTTTAATAGTTAAATCTGAGGAACCTGACATGCATGTTGGTACAATTATGGAGTCTCGTGATGCTACCTTCTTT
Reverse complement sequence
AAAGAAGGTAGCATCACGAGACTCCATAATTGTACCAACATGCATGTCAGGTTCCTCAGATTTAACTATTAAAAATCTATAGGCAATGCTGTGATAAGCA[T/A]
ATCCCAGAATGACACAGTCCATAGTCTTAGGTCCAAGTTTGCGCTTCTTCGTTATTGGTACATTGACTTTCGCCAAGCACCCCATGTGCGCAAGTAAGAA
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.90% | 1.40% | 10.71% | 49.01% | NA |
| All Indica | 2759 | 7.40% | 2.20% | 13.27% | 77.13% | NA |
| All Japonica | 1512 | 99.10% | 0.10% | 0.26% | 0.53% | NA |
| Aus | 269 | 0.40% | 0.40% | 43.87% | 55.39% | NA |
| Indica I | 595 | 3.40% | 2.00% | 6.89% | 87.73% | NA |
| Indica II | 465 | 24.50% | 1.70% | 8.39% | 65.38% | NA |
| Indica III | 913 | 2.70% | 1.90% | 21.47% | 73.93% | NA |
| Indica Intermediate | 786 | 5.60% | 3.20% | 11.45% | 79.77% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 98.80% | 0.20% | 0.40% | 0.60% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 87.50% | 0.00% | 9.38% | 3.12% | NA |
| Intermediate | 90 | 57.80% | 1.10% | 10.00% | 31.11% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0411116007 | A -> DEL | LOC_Os04g19940.1 | N | frameshift_variant | Average:23.209; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0411116007 | A -> T | LOC_Os04g19940.1 | missense_variant ; p.Tyr29Phe; MODERATE | nonsynonymous_codon ; Y29F | Average:23.209; most accessible tissue: Minghui63 panicle, score: 34.226 | benign  |
0.293 |
DELETERIOUS | 0.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0411116007 | NA | 6.70E-22 | mr1122 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411116007 | NA | 8.69E-27 | mr1130 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411116007 | NA | 2.85E-13 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411116007 | NA | 1.07E-20 | mr1254 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411116007 | NA | 6.89E-12 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411116007 | NA | 4.36E-25 | mr1903 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411116007 | NA | 6.81E-09 | mr1336_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411116007 | NA | 7.71E-06 | mr1579_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411116007 | NA | 6.66E-17 | mr1712_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |