\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411115062:

Variant ID: vg0411115062 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 11115062
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.77, T: 0.23, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TTCATGGTGTTGGCACGGTAGATCTGAAGTTTACTTCGGGAAAGATCGTGCAGCTGAAGAACGTGCAGCATGTCTCTTCTATCGACAGAAATCTTGTTAG[T/A]
GGCTCCCGTCTGACTAGAGACGGATTTAAGTTGTTTTTTGAGTCTAATAAAGTAGTCGTGTCTAAACATGGATATTTTATTGGTAAAGGTTATGAGTGCG

Reverse complement sequence

CGCACTCATAACCTTTACCAATAAAATATCCATGTTTAGACACGACTACTTTATTAGACTCAAAAAACAACTTAAATCCGTCTCTAGTCAGACGGGAGCC[A/T]
CTAACAAGATTTCTGTCGATAGAAGAGACATGCTGCACGTTCTTCAGCTGCACGATCTTTCCCGAAGTAAACTTCAGATCTACCGTGCCAACACCATGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.90% 35.60% 1.99% 22.58% NA
All Indica  2759 9.20% 49.00% 3.37% 38.42% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 0.00% 100.00% 0.00% 0.00% NA
Indica I  595 6.90% 23.90% 4.54% 64.71% NA
Indica II  465 26.70% 52.70% 2.58% 18.06% NA
Indica III  913 3.90% 59.30% 3.07% 33.73% NA
Indica Intermediate  786 6.60% 54.10% 3.31% 36.01% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 54.40% 36.70% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0411115062 T -> DEL N N silent_mutation Average:26.427; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N
vg0411115062 T -> A LOC_Os04g19940.1 upstream_gene_variant ; 860.0bp to feature; MODIFIER silent_mutation Average:26.427; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N
vg0411115062 T -> A LOC_Os04g19930.1 downstream_gene_variant ; 1.0bp to feature; MODIFIER silent_mutation Average:26.427; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N
vg0411115062 T -> A LOC_Os04g19930-LOC_Os04g19940 intergenic_region ; MODIFIER silent_mutation Average:26.427; most accessible tissue: Minghui63 young leaf, score: 43.347 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0411115062 NA 2.35E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062 NA 7.58E-06 mr1304 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062 NA 1.16E-13 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062 NA 2.68E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062 NA 9.91E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062 NA 1.13E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062 NA 3.34E-07 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062 NA 1.38E-08 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062 NA 5.58E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062 NA 2.61E-19 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062 NA 3.29E-10 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062 1.56E-11 9.55E-30 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062 5.76E-11 1.05E-18 mr1846 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062 NA 1.82E-06 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062 NA 6.18E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062 1.99E-06 3.32E-19 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062 3.67E-06 5.49E-15 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062 2.34E-13 1.74E-50 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062 6.46E-12 7.20E-32 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251