Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411115062:

Variant ID: vg0411115062 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 11115062
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.77, T: 0.23, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

TTCATGGTGTTGGCACGGTAGATCTGAAGTTTACTTCGGGAAAGATCGTGCAGCTGAAGAACGTGCAGCATGTCTCTTCTATCGACAGAAATCTTGTTAG[T/A]
GGCTCCCGTCTGACTAGAGACGGATTTAAGTTGTTTTTTGAGTCTAATAAAGTAGTCGTGTCTAAACATGGATATTTTATTGGTAAAGGTTATGAGTGCG

Reverse complement sequence

CGCACTCATAACCTTTACCAATAAAATATCCATGTTTAGACACGACTACTTTATTAGACTCAAAAAACAACTTAAATCCGTCTCTAGTCAGACGGGAGCC[A/T]
CTAACAAGATTTCTGTCGATAGAAGAGACATGCTGCACGTTCTTCAGCTGCACGATCTTTCCCGAAGTAAACTTCAGATCTACCGTGCCAACACCATGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.90%	35.60%	1.99%	22.58%	NA
All Indica	2759	9.20%	49.00%	3.37%	38.42%	NA
All Japonica	1512	99.10%	0.90%	0.00%	0.00%	NA
Aus	269	0.00%	100.00%	0.00%	0.00%	NA
Indica I	595	6.90%	23.90%	4.54%	64.71%	NA
Indica II	465	26.70%	52.70%	2.58%	18.06%	NA
Indica III	913	3.90%	59.30%	3.07%	33.73%	NA
Indica Intermediate	786	6.60%	54.10%	3.31%	36.01%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	54.40%	36.70%	1.11%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0411115062	T -> DEL	N	N	silent_mutation	Average:26.427; most accessible tissue: Minghui63 young leaf, score: 43.347	N	N	N	N
vg0411115062	T -> A	LOC_Os04g19940.1	upstream_gene_variant ; 860.0bp to feature; MODIFIER	silent_mutation	Average:26.427; most accessible tissue: Minghui63 young leaf, score: 43.347	N	N	N	N
vg0411115062	T -> A	LOC_Os04g19930.1	downstream_gene_variant ; 1.0bp to feature; MODIFIER	silent_mutation	Average:26.427; most accessible tissue: Minghui63 young leaf, score: 43.347	N	N	N	N
vg0411115062	T -> A	LOC_Os04g19930-LOC_Os04g19940	intergenic_region ; MODIFIER	silent_mutation	Average:26.427; most accessible tissue: Minghui63 young leaf, score: 43.347	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0411115062	NA	2.35E-06	mr1062	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062	NA	7.58E-06	mr1304	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062	NA	1.16E-13	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062	NA	2.68E-06	mr1386	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062	NA	9.91E-09	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062	NA	1.13E-07	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062	NA	3.34E-07	mr1414	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062	NA	1.38E-08	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062	NA	5.58E-06	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062	NA	2.61E-19	mr1830	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062	NA	3.29E-10	mr1830	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062	1.56E-11	9.55E-30	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062	5.76E-11	1.05E-18	mr1846	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062	NA	1.82E-06	mr1304_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062	NA	6.18E-07	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062	1.99E-06	3.32E-19	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062	3.67E-06	5.49E-15	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062	2.34E-13	1.74E-50	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411115062	6.46E-12	7.20E-32	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251