\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0411097811:

Variant ID: vg0411097811 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 11097811
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.09, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


GCAACAAGATCTCCGACATAACCGACGATGTCATCATCGCCGCCTTTACTAAAGGCATTCGCCACGAGGACCTAGTCGACAAGTTCGGACGCAAATCTCC[C/T]
AGGACAGGAAGGATATCTTTGCATGGAAACCATCCGATATGCCTGGTATTCCTAGAGAGGTGATTGAGCACTCTTTACATGTTAAGGAAGACGCCAAACC

Reverse complement sequence

GGTTTGGCGTCTTCCTTAACATGTAAAGAGTGCTCAATCACCTCTCTAGGAATACCAGGCATATCGGATGGTTTCCATGCAAAGATATCCTTCCTGTCCT[G/A]
GGAGATTTGCGTCCGAACTTGTCGACTAGGTCCTCGTGGCGAATGCCTTTAGTAAAGGCGGCGATGATGACATCGTCGGTTATGTCGGAGATCTTGTTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.20% 35.50% 0.57% 25.73% NA
All Indica  2759 6.80% 49.00% 0.91% 43.35% NA
All Japonica  1512 98.30% 0.90% 0.00% 0.86% NA
Aus  269 0.00% 100.00% 0.00% 0.00% NA
Indica I  595 4.20% 23.70% 1.68% 70.42% NA
Indica II  465 23.90% 52.70% 0.43% 23.01% NA
Indica III  913 1.30% 59.10% 0.66% 38.88% NA
Indica Intermediate  786 5.00% 54.10% 0.89% 40.08% NA
Temperate Japonica  767 97.90% 0.40% 0.00% 1.69% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 55.60% 34.40% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0411097811 C -> DEL N N silent_mutation Average:29.46; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0411097811 C -> T LOC_Os04g19910.1 downstream_gene_variant ; 3456.0bp to feature; MODIFIER silent_mutation Average:29.46; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0411097811 C -> T LOC_Os04g19900.1 intron_variant ; MODIFIER silent_mutation Average:29.46; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0411097811 NA 4.97E-17 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811 NA 1.83E-07 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811 NA 6.73E-23 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811 NA 2.84E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811 NA 9.58E-24 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811 NA 9.84E-13 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811 NA 8.76E-06 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811 NA 1.31E-27 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811 NA 1.39E-07 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811 NA 1.24E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811 3.26E-06 2.34E-06 mr1638 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811 NA 3.04E-16 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811 NA 2.39E-06 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811 7.69E-06 3.27E-22 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811 NA 2.58E-10 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811 NA 4.32E-14 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811 NA 1.21E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811 NA 2.10E-32 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0411097811 NA 1.79E-15 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251