\
| Variant ID: vg0411097811 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 11097811 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.09, others allele: 0.00, population size: 209. )
GCAACAAGATCTCCGACATAACCGACGATGTCATCATCGCCGCCTTTACTAAAGGCATTCGCCACGAGGACCTAGTCGACAAGTTCGGACGCAAATCTCC[C/T]
AGGACAGGAAGGATATCTTTGCATGGAAACCATCCGATATGCCTGGTATTCCTAGAGAGGTGATTGAGCACTCTTTACATGTTAAGGAAGACGCCAAACC
GGTTTGGCGTCTTCCTTAACATGTAAAGAGTGCTCAATCACCTCTCTAGGAATACCAGGCATATCGGATGGTTTCCATGCAAAGATATCCTTCCTGTCCT[G/A]
GGAGATTTGCGTCCGAACTTGTCGACTAGGTCCTCGTGGCGAATGCCTTTAGTAAAGGCGGCGATGATGACATCGTCGGTTATGTCGGAGATCTTGTTGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.20% | 35.50% | 0.57% | 25.73% | NA |
| All Indica | 2759 | 6.80% | 49.00% | 0.91% | 43.35% | NA |
| All Japonica | 1512 | 98.30% | 0.90% | 0.00% | 0.86% | NA |
| Aus | 269 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 4.20% | 23.70% | 1.68% | 70.42% | NA |
| Indica II | 465 | 23.90% | 52.70% | 0.43% | 23.01% | NA |
| Indica III | 913 | 1.30% | 59.10% | 0.66% | 38.88% | NA |
| Indica Intermediate | 786 | 5.00% | 54.10% | 0.89% | 40.08% | NA |
| Temperate Japonica | 767 | 97.90% | 0.40% | 0.00% | 1.69% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 34.40% | 2.22% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0411097811 | C -> DEL | N | N | silent_mutation | Average:29.46; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0411097811 | C -> T | LOC_Os04g19910.1 | downstream_gene_variant ; 3456.0bp to feature; MODIFIER | silent_mutation | Average:29.46; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0411097811 | C -> T | LOC_Os04g19900.1 | intron_variant ; MODIFIER | silent_mutation | Average:29.46; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0411097811 | NA | 4.97E-17 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411097811 | NA | 1.83E-07 | mr1062 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411097811 | NA | 6.73E-23 | mr1168 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411097811 | NA | 2.84E-08 | mr1222 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411097811 | NA | 9.58E-24 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411097811 | NA | 9.84E-13 | mr1386 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411097811 | NA | 8.76E-06 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411097811 | NA | 1.31E-27 | mr1414 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411097811 | NA | 1.39E-07 | mr1414 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411097811 | NA | 1.24E-08 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411097811 | 3.26E-06 | 2.34E-06 | mr1638 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411097811 | NA | 3.04E-16 | mr1830 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411097811 | NA | 2.39E-06 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411097811 | 7.69E-06 | 3.27E-22 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411097811 | NA | 2.58E-10 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411097811 | NA | 4.32E-14 | mr1830_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411097811 | NA | 1.21E-07 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411097811 | NA | 2.10E-32 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0411097811 | NA | 1.79E-15 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |