\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410985561:

Variant ID: vg0410985561 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10985561
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.08, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTTACTTTAGATCTTTGACCTTGTTAGACTTACTTTATGGATGTCTAAATTTAATCTTCAGCAATAAAAGATGTCTAAATTTAATCAGTGATTCTTCC[G/A]
GGTCCATTCTACATAACAGGATTATGGGATAACTACCTTAAAGGAAGAGTCTGAACAGTGTGGCTCTTTCAAAGGAGATAGACTAGATGGGGCTATTATT

Reverse complement sequence

AATAATAGCCCCATCTAGTCTATCTCCTTTGAAAGAGCCACACTGTTCAGACTCTTCCTTTAAGGTAGTTATCCCATAATCCTGTTATGTAGAATGGACC[C/T]
GGAAGAATCACTGATTAAATTTAGACATCTTTTATTGCTGAAGATTAAATTTAGACATCCATAAAGTAAGTCTAACAAGGTCAAAGATCTAAAGTAACAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 33.80% 1.99% 0.00% NA
All Indica  2759 94.70% 5.10% 0.18% 0.00% NA
All Japonica  1512 6.00% 88.60% 5.42% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 77.20% 22.20% 0.65% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 96.30% 3.40% 0.25% 0.00% NA
Temperate Japonica  767 8.90% 81.40% 9.78% 0.00% NA
Tropical Japonica  504 3.20% 96.60% 0.20% 0.00% NA
Japonica Intermediate  241 2.90% 94.60% 2.49% 0.00% NA
VI/Aromatic  96 16.70% 83.30% 0.00% 0.00% NA
Intermediate  90 50.00% 43.30% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410985561 G -> A LOC_Os04g19684.3 downstream_gene_variant ; 1703.0bp to feature; MODIFIER silent_mutation Average:47.538; most accessible tissue: Callus, score: 76.578 N N N N
vg0410985561 G -> A LOC_Os04g19684.1 intron_variant ; MODIFIER silent_mutation Average:47.538; most accessible tissue: Callus, score: 76.578 N N N N
vg0410985561 G -> A LOC_Os04g19684.2 intron_variant ; MODIFIER silent_mutation Average:47.538; most accessible tissue: Callus, score: 76.578 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410985561 1.42E-11 3.31E-20 mr1035 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 5.31E-07 1.71E-08 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 1.32E-08 3.52E-23 mr1062 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 NA 3.17E-11 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 NA 3.49E-14 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 NA 1.41E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 NA 5.81E-09 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 1.66E-06 NA mr1525 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 2.28E-06 2.27E-06 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 5.05E-10 1.11E-16 mr1626 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 3.02E-06 2.43E-07 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 2.44E-06 7.44E-25 mr1631 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 NA 3.59E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 1.09E-06 7.84E-17 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 7.75E-07 3.95E-22 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 4.21E-07 6.22E-11 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 NA 4.17E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 NA 3.70E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 1.43E-09 6.61E-38 mr1631_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 5.10E-06 4.32E-10 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 NA 6.14E-18 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 NA 3.38E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410985561 NA 3.02E-14 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251