\
| Variant ID: vg0410982826 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10982826 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CGGAGGCATTGCATCACGTGAGAAACCCTAGCCATCACTTCCCTCCTCGAGCAAAACCCTAGCCGCGCGCGGGTGCTAGCACATCTGCACATGGCGTTCC[A/G]
TCCCTGTACGTATGGATACCGGTAGAGGCGCCGCTGGTTTGCGGTGCTGATCGGCATGGGAGTACGGCGAGGAGAACGCACGAGGAGGAGAAGGTCGAGC
GCTCGACCTTCTCCTCCTCGTGCGTTCTCCTCGCCGTACTCCCATGCCGATCAGCACCGCAAACCAGCGGCGCCTCTACCGGTATCCATACGTACAGGGA[T/C]
GGAACGCCATGTGCAGATGTGCTAGCACCCGCGCGCGGCTAGGGTTTTGCTCGAGGAGGGAAGTGATGGCTAGGGTTTCTCACGTGATGCAATGCCTCCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.50% | 14.40% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 62.30% | 37.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.80% | 28.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 17.70% | 79.20% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 23.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410982826 | A -> G | LOC_Os04g19684.1 | downstream_gene_variant ; 1582.0bp to feature; MODIFIER | silent_mutation | Average:59.374; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0410982826 | A -> G | LOC_Os04g19684.2 | downstream_gene_variant ; 1582.0bp to feature; MODIFIER | silent_mutation | Average:59.374; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0410982826 | A -> G | LOC_Os04g19684.3 | downstream_gene_variant ; 4438.0bp to feature; MODIFIER | silent_mutation | Average:59.374; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg0410982826 | A -> G | LOC_Os04g19670-LOC_Os04g19684 | intergenic_region ; MODIFIER | silent_mutation | Average:59.374; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410982826 | NA | 3.80E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410982826 | NA | 6.06E-06 | mr1087 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410982826 | NA | 1.00E-06 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410982826 | NA | 1.99E-09 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410982826 | NA | 9.58E-08 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410982826 | NA | 8.62E-08 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410982826 | NA | 1.64E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410982826 | NA | 2.45E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410982826 | NA | 8.39E-07 | mr1319 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410982826 | NA | 6.04E-16 | mr1330 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410982826 | NA | 2.59E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410982826 | NA | 2.86E-12 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410982826 | NA | 2.34E-08 | mr1449 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410982826 | NA | 5.80E-17 | mr1454 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410982826 | NA | 6.63E-11 | mr1454 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410982826 | NA | 5.96E-20 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410982826 | NA | 2.29E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410982826 | NA | 1.65E-07 | mr1715 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410982826 | NA | 1.33E-06 | mr1786 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410982826 | NA | 1.50E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410982826 | NA | 9.70E-13 | mr1864 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |