Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0410982826:

Variant ID: vg0410982826 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 10982826
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGGAGGCATTGCATCACGTGAGAAACCCTAGCCATCACTTCCCTCCTCGAGCAAAACCCTAGCCGCGCGCGGGTGCTAGCACATCTGCACATGGCGTTCC[A/G]
TCCCTGTACGTATGGATACCGGTAGAGGCGCCGCTGGTTTGCGGTGCTGATCGGCATGGGAGTACGGCGAGGAGAACGCACGAGGAGGAGAAGGTCGAGC

Reverse complement sequence

GCTCGACCTTCTCCTCCTCGTGCGTTCTCCTCGCCGTACTCCCATGCCGATCAGCACCGCAAACCAGCGGCGCCTCTACCGGTATCCATACGTACAGGGA[T/C]
GGAACGCCATGTGCAGATGTGCTAGCACCCGCGCGCGGCTAGGGTTTTGCTCGAGGAGGGAAGTGATGGCTAGGGTTTCTCACGTGATGCAATGCCTCCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.50%	14.40%	0.11%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	62.30%	37.70%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	96.20%	3.80%	0.00%	0.00%	NA
Tropical Japonica	504	6.20%	93.80%	0.00%	0.00%	NA
Japonica Intermediate	241	71.80%	28.20%	0.00%	0.00%	NA
VI/Aromatic	96	17.70%	79.20%	3.12%	0.00%	NA
Intermediate	90	74.40%	23.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0410982826	A -> G	LOC_Os04g19684.1	downstream_gene_variant ; 1582.0bp to feature; MODIFIER	silent_mutation	Average:59.374; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0410982826	A -> G	LOC_Os04g19684.2	downstream_gene_variant ; 1582.0bp to feature; MODIFIER	silent_mutation	Average:59.374; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0410982826	A -> G	LOC_Os04g19684.3	downstream_gene_variant ; 4438.0bp to feature; MODIFIER	silent_mutation	Average:59.374; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0410982826	A -> G	LOC_Os04g19670-LOC_Os04g19684	intergenic_region ; MODIFIER	silent_mutation	Average:59.374; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0410982826	NA	3.80E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826	NA	6.06E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826	NA	1.00E-06	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826	NA	1.99E-09	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826	NA	9.58E-08	mr1194	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826	NA	8.62E-08	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826	NA	1.64E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826	NA	2.45E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826	NA	8.39E-07	mr1319	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826	NA	6.04E-16	mr1330	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826	NA	2.59E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826	NA	2.86E-12	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826	NA	2.34E-08	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826	NA	5.80E-17	mr1454	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826	NA	6.63E-11	mr1454	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826	NA	5.96E-20	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826	NA	2.29E-07	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826	NA	1.65E-07	mr1715	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826	NA	1.33E-06	mr1786	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826	NA	1.50E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826	NA	9.70E-13	mr1864	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251