Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410982826:

Variant ID: vg0410982826 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10982826
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGAGGCATTGCATCACGTGAGAAACCCTAGCCATCACTTCCCTCCTCGAGCAAAACCCTAGCCGCGCGCGGGTGCTAGCACATCTGCACATGGCGTTCC[A/G]
TCCCTGTACGTATGGATACCGGTAGAGGCGCCGCTGGTTTGCGGTGCTGATCGGCATGGGAGTACGGCGAGGAGAACGCACGAGGAGGAGAAGGTCGAGC

Reverse complement sequence

GCTCGACCTTCTCCTCCTCGTGCGTTCTCCTCGCCGTACTCCCATGCCGATCAGCACCGCAAACCAGCGGCGCCTCTACCGGTATCCATACGTACAGGGA[T/C]
GGAACGCCATGTGCAGATGTGCTAGCACCCGCGCGCGGCTAGGGTTTTGCTCGAGGAGGGAAGTGATGGCTAGGGTTTCTCACGTGATGCAATGCCTCCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.50% 14.40% 0.11% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 62.30% 37.70% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 96.20% 3.80% 0.00% 0.00% NA
Tropical Japonica  504 6.20% 93.80% 0.00% 0.00% NA
Japonica Intermediate  241 71.80% 28.20% 0.00% 0.00% NA
VI/Aromatic  96 17.70% 79.20% 3.12% 0.00% NA
Intermediate  90 74.40% 23.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410982826 A -> G LOC_Os04g19684.1 downstream_gene_variant ; 1582.0bp to feature; MODIFIER silent_mutation Average:59.374; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0410982826 A -> G LOC_Os04g19684.2 downstream_gene_variant ; 1582.0bp to feature; MODIFIER silent_mutation Average:59.374; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0410982826 A -> G LOC_Os04g19684.3 downstream_gene_variant ; 4438.0bp to feature; MODIFIER silent_mutation Average:59.374; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0410982826 A -> G LOC_Os04g19670-LOC_Os04g19684 intergenic_region ; MODIFIER silent_mutation Average:59.374; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410982826 NA 3.80E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826 NA 6.06E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826 NA 1.00E-06 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826 NA 1.99E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826 NA 9.58E-08 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826 NA 8.62E-08 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826 NA 1.64E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826 NA 2.45E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826 NA 8.39E-07 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826 NA 6.04E-16 mr1330 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826 NA 2.59E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826 NA 2.86E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826 NA 2.34E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826 NA 5.80E-17 mr1454 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826 NA 6.63E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826 NA 5.96E-20 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826 NA 2.29E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826 NA 1.65E-07 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826 NA 1.33E-06 mr1786 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826 NA 1.50E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410982826 NA 9.70E-13 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251