Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0410974517:

Variant ID: vg0410974517 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 10974517
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCCAAGCAACCTTCCCATTTTGTGCTAGAATTTAAACCGAAGCAATTCCAATTTTATTGGAATTAATTGTTAAACCCATCCTTTGATCTTAAACCTATC[C/A]
TTCGATTCCAAGCATATCCTTAGTTCCCTTTCCAAATTTCAAATATCTAAATTCCTCCCTTTGATCTAGCCATCATTAATCTCTATGGCTTGATTTCCTA

Reverse complement sequence

TAGGAAATCAAGCCATAGAGATTAATGATGGCTAGATCAAAGGGAGGAATTTAGATATTTGAAATTTGGAAAGGGAACTAAGGATATGCTTGGAATCGAA[G/T]
GATAGGTTTAAGATCAAAGGATGGGTTTAACAATTAATTCCAATAAAATTGGAATTGCTTCGGTTTAAATTCTAGCACAAAATGGGAAGGTTGCTTGGAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.10%	1.90%	1.93%	13.06%	NA
All Indica	2759	99.70%	0.00%	0.04%	0.22%	NA
All Japonica	1512	53.30%	5.90%	5.62%	35.19%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.00%	0.00%	0.86%	NA
Indica III	913	99.80%	0.00%	0.11%	0.11%	NA
Indica Intermediate	786	99.90%	0.00%	0.00%	0.13%	NA
Temperate Japonica	767	78.20%	10.30%	8.21%	3.26%	NA
Tropical Japonica	504	7.90%	1.40%	2.78%	87.90%	NA
Japonica Intermediate	241	68.90%	1.20%	3.32%	26.56%	NA
VI/Aromatic	96	29.20%	0.00%	1.04%	69.79%	NA
Intermediate	90	81.10%	1.10%	4.44%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0410974517	C -> DEL	N	N	silent_mutation	Average:27.744; most accessible tissue: Zhenshan97 flower, score: 32.793	N	N	N	N
vg0410974517	C -> A	LOC_Os04g19660.1	downstream_gene_variant ; 3271.0bp to feature; MODIFIER	silent_mutation	Average:27.744; most accessible tissue: Zhenshan97 flower, score: 32.793	N	N	N	N
vg0410974517	C -> A	LOC_Os04g19670.1	downstream_gene_variant ; 784.0bp to feature; MODIFIER	silent_mutation	Average:27.744; most accessible tissue: Zhenshan97 flower, score: 32.793	N	N	N	N
vg0410974517	C -> A	LOC_Os04g19660-LOC_Os04g19670	intergenic_region ; MODIFIER	silent_mutation	Average:27.744; most accessible tissue: Zhenshan97 flower, score: 32.793	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0410974517	3.27E-07	NA	mr1035	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517	NA	8.50E-08	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517	2.60E-08	NA	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517	NA	2.30E-10	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517	3.19E-07	9.51E-09	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517	6.32E-07	6.32E-07	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517	1.86E-06	NA	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517	NA	6.24E-07	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517	1.25E-06	NA	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517	NA	7.47E-06	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517	3.76E-08	NA	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517	8.16E-06	2.55E-09	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517	3.50E-07	3.49E-07	mr1525_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517	2.26E-08	NA	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517	NA	1.12E-08	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251