\
| Variant ID: vg0410974517 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10974517 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTCCAAGCAACCTTCCCATTTTGTGCTAGAATTTAAACCGAAGCAATTCCAATTTTATTGGAATTAATTGTTAAACCCATCCTTTGATCTTAAACCTATC[C/A]
TTCGATTCCAAGCATATCCTTAGTTCCCTTTCCAAATTTCAAATATCTAAATTCCTCCCTTTGATCTAGCCATCATTAATCTCTATGGCTTGATTTCCTA
TAGGAAATCAAGCCATAGAGATTAATGATGGCTAGATCAAAGGGAGGAATTTAGATATTTGAAATTTGGAAAGGGAACTAAGGATATGCTTGGAATCGAA[G/T]
GATAGGTTTAAGATCAAAGGATGGGTTTAACAATTAATTCCAATAAAATTGGAATTGCTTCGGTTTAAATTCTAGCACAAAATGGGAAGGTTGCTTGGAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.10% | 1.90% | 1.93% | 13.06% | NA |
| All Indica | 2759 | 99.70% | 0.00% | 0.04% | 0.22% | NA |
| All Japonica | 1512 | 53.30% | 5.90% | 5.62% | 35.19% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.00% | 0.00% | 0.86% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 78.20% | 10.30% | 8.21% | 3.26% | NA |
| Tropical Japonica | 504 | 7.90% | 1.40% | 2.78% | 87.90% | NA |
| Japonica Intermediate | 241 | 68.90% | 1.20% | 3.32% | 26.56% | NA |
| VI/Aromatic | 96 | 29.20% | 0.00% | 1.04% | 69.79% | NA |
| Intermediate | 90 | 81.10% | 1.10% | 4.44% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410974517 | C -> DEL | N | N | silent_mutation | Average:27.744; most accessible tissue: Zhenshan97 flower, score: 32.793 | N | N | N | N |
| vg0410974517 | C -> A | LOC_Os04g19660.1 | downstream_gene_variant ; 3271.0bp to feature; MODIFIER | silent_mutation | Average:27.744; most accessible tissue: Zhenshan97 flower, score: 32.793 | N | N | N | N |
| vg0410974517 | C -> A | LOC_Os04g19670.1 | downstream_gene_variant ; 784.0bp to feature; MODIFIER | silent_mutation | Average:27.744; most accessible tissue: Zhenshan97 flower, score: 32.793 | N | N | N | N |
| vg0410974517 | C -> A | LOC_Os04g19660-LOC_Os04g19670 | intergenic_region ; MODIFIER | silent_mutation | Average:27.744; most accessible tissue: Zhenshan97 flower, score: 32.793 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410974517 | 3.27E-07 | NA | mr1035 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410974517 | NA | 8.50E-08 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410974517 | 2.60E-08 | NA | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410974517 | NA | 2.30E-10 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410974517 | 3.19E-07 | 9.51E-09 | mr1525 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410974517 | 6.32E-07 | 6.32E-07 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410974517 | 1.86E-06 | NA | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410974517 | NA | 6.24E-07 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410974517 | 1.25E-06 | NA | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410974517 | NA | 7.47E-06 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410974517 | 3.76E-08 | NA | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410974517 | 8.16E-06 | 2.55E-09 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410974517 | 3.50E-07 | 3.49E-07 | mr1525_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410974517 | 2.26E-08 | NA | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410974517 | NA | 1.12E-08 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |