\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410974517:

Variant ID: vg0410974517 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10974517
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCCAAGCAACCTTCCCATTTTGTGCTAGAATTTAAACCGAAGCAATTCCAATTTTATTGGAATTAATTGTTAAACCCATCCTTTGATCTTAAACCTATC[C/A]
TTCGATTCCAAGCATATCCTTAGTTCCCTTTCCAAATTTCAAATATCTAAATTCCTCCCTTTGATCTAGCCATCATTAATCTCTATGGCTTGATTTCCTA

Reverse complement sequence

TAGGAAATCAAGCCATAGAGATTAATGATGGCTAGATCAAAGGGAGGAATTTAGATATTTGAAATTTGGAAAGGGAACTAAGGATATGCTTGGAATCGAA[G/T]
GATAGGTTTAAGATCAAAGGATGGGTTTAACAATTAATTCCAATAAAATTGGAATTGCTTCGGTTTAAATTCTAGCACAAAATGGGAAGGTTGCTTGGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.10% 1.90% 1.93% 13.06% NA
All Indica  2759 99.70% 0.00% 0.04% 0.22% NA
All Japonica  1512 53.30% 5.90% 5.62% 35.19% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.00% 0.00% 0.86% NA
Indica III  913 99.80% 0.00% 0.11% 0.11% NA
Indica Intermediate  786 99.90% 0.00% 0.00% 0.13% NA
Temperate Japonica  767 78.20% 10.30% 8.21% 3.26% NA
Tropical Japonica  504 7.90% 1.40% 2.78% 87.90% NA
Japonica Intermediate  241 68.90% 1.20% 3.32% 26.56% NA
VI/Aromatic  96 29.20% 0.00% 1.04% 69.79% NA
Intermediate  90 81.10% 1.10% 4.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410974517 C -> DEL N N silent_mutation Average:27.744; most accessible tissue: Zhenshan97 flower, score: 32.793 N N N N
vg0410974517 C -> A LOC_Os04g19660.1 downstream_gene_variant ; 3271.0bp to feature; MODIFIER silent_mutation Average:27.744; most accessible tissue: Zhenshan97 flower, score: 32.793 N N N N
vg0410974517 C -> A LOC_Os04g19670.1 downstream_gene_variant ; 784.0bp to feature; MODIFIER silent_mutation Average:27.744; most accessible tissue: Zhenshan97 flower, score: 32.793 N N N N
vg0410974517 C -> A LOC_Os04g19660-LOC_Os04g19670 intergenic_region ; MODIFIER silent_mutation Average:27.744; most accessible tissue: Zhenshan97 flower, score: 32.793 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410974517 3.27E-07 NA mr1035 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517 NA 8.50E-08 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517 2.60E-08 NA mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517 NA 2.30E-10 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517 3.19E-07 9.51E-09 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517 6.32E-07 6.32E-07 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517 1.86E-06 NA mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517 NA 6.24E-07 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517 1.25E-06 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517 NA 7.47E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517 3.76E-08 NA mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517 8.16E-06 2.55E-09 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517 3.50E-07 3.49E-07 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517 2.26E-08 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410974517 NA 1.12E-08 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251