Search for Variation information by Variation ID:
Detailed information for vg0410967768:
| Variant ID: vg0410967768 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10967768 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
AACAACATCCGCAATCAAGCTCCACGTCCTGTTGCAGCTCCAACACAGCAACAACCTGCCAAGAGGGAGCAAGGCAGCAAGCCCGTAGTGTGCTTCAACT[A/G]
TGGAGACCCAGGACATTATGCTGACAAGTGTCCGAAGCCCCGACGCGCGAAGGTTGTCCCTACCCAGAGCAACTCTATCGCACCAGCATCAAAGGCCCGT
Reverse complement sequence
ACGGGCCTTTGATGCTGGTGCGATAGAGTTGCTCTGGGTAGGGACAACCTTCGCGCGTCGGGGCTTCGGACACTTGTCAGCATAATGTCCTGGGTCTCCA[T/C]
AGTTGAAGCACACTACGGGCTTGCTGCCTTGCTCCCTCTTGGCAGGTTGTTGCTGTGTTGGAGCTGCAACAGGACGTGGAGCTTGATTGCGGATGTTGTT
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 21.30% | 3.00% | 12.02% | 63.73% | NA |
| All Indica | 2759 | 2.40% | 0.80% | 14.43% | 82.35% | NA |
| All Japonica | 1512 | 60.30% | 0.80% | 0.26% | 38.62% | NA |
| Aus | 269 | 1.10% | 38.30% | 50.19% | 10.41% | NA |
| Indica I | 595 | 2.20% | 0.30% | 7.23% | 90.25% | NA |
| Indica II | 465 | 3.00% | 0.40% | 15.48% | 81.08% | NA |
| Indica III | 913 | 2.00% | 1.00% | 21.03% | 76.01% | NA |
| Indica Intermediate | 786 | 2.80% | 1.10% | 11.58% | 84.48% | NA |
| Temperate Japonica | 767 | 96.10% | 0.00% | 0.00% | 3.91% | NA |
| Tropical Japonica | 504 | 4.60% | 0.00% | 0.40% | 95.04% | NA |
| Japonica Intermediate | 241 | 63.10% | 5.00% | 0.83% | 31.12% | NA |
| VI/Aromatic | 96 | 1.00% | 2.10% | 19.79% | 77.08% | NA |
| Intermediate | 90 | 25.60% | 1.10% | 13.33% | 60.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410967768 | A -> DEL | LOC_Os04g19660.1 | N | frameshift_variant | Average:8.192; most accessible tissue: Callus, score: 22.649 | N | N | N | N |
| vg0410967768 | A -> G | LOC_Os04g19660.1 | missense_variant ; p.Tyr315Cys; MODERATE | nonsynonymous_codon ; Y315C | Average:8.192; most accessible tissue: Callus, score: 22.649 | benign  |
-0.226 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410967768 | NA | 7.87E-06 | mr1276 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410967768 | NA | 7.97E-06 | mr1333 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410967768 | NA | 2.85E-09 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410967768 | NA | 1.93E-08 | mr1691 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410967768 | 1.11E-06 | 4.29E-06 | mr1733 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410967768 | NA | 6.19E-09 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410967768 | NA | 9.82E-06 | mr1668_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410967768 | NA | 2.41E-08 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |