\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410901198:

Variant ID: vg0410901198 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10901198
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


GGCCAAAGAATACATCGAGTGAACGGAGGATCTACAAGATATTAAAGTCCAATGAGTTTTGGAACCCAATTCGGCCTCCGGAGACAGTACTGACTTCAAA[C/T]
GGACCTAGCGCCTTCATGCCAACTCCGATTTGGATGATCTTGGATTACATGGAAAGCTTATCTCGCTAGCTTTCAAACGCATCCAGTCTCATGTCCAAAT

Reverse complement sequence

ATTTGGACATGAGACTGGATGCGTTTGAAAGCTAGCGAGATAAGCTTTCCATGTAATCCAAGATCATCCAAATCGGAGTTGGCATGAAGGCGCTAGGTCC[G/A]
TTTGAAGTCAGTACTGTCTCCGGAGGCCGAATTGGGTTCCAAAACTCATTGGACTTTAATATCTTGTAGATCCTCCGTTCACTCGATGTATTCTTTGGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.30% 28.70% 0.02% 0.00% NA
All Indica  2759 57.00% 42.90% 0.04% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 52.80% 47.20% 0.00% 0.00% NA
Indica I  595 77.30% 22.70% 0.00% 0.00% NA
Indica II  465 49.20% 50.80% 0.00% 0.00% NA
Indica III  913 52.20% 47.80% 0.00% 0.00% NA
Indica Intermediate  786 51.90% 48.00% 0.13% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410901198 C -> T LOC_Os04g19580.1 upstream_gene_variant ; 682.0bp to feature; MODIFIER silent_mutation Average:35.643; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0410901198 C -> T LOC_Os04g19590.1 upstream_gene_variant ; 4201.0bp to feature; MODIFIER silent_mutation Average:35.643; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0410901198 C -> T LOC_Os04g19580-LOC_Os04g19590 intergenic_region ; MODIFIER silent_mutation Average:35.643; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410901198 NA 3.18E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198 NA 4.78E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198 NA 6.53E-08 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198 NA 5.39E-07 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198 NA 2.25E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198 NA 2.17E-16 mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198 4.60E-06 6.06E-11 mr1830 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198 2.42E-08 1.24E-20 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198 1.13E-08 1.81E-16 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198 NA 1.29E-06 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198 NA 3.50E-07 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198 NA 1.08E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198 NA 2.76E-06 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198 NA 2.22E-16 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198 NA 4.13E-14 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198 1.64E-09 3.93E-34 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198 1.04E-10 5.10E-31 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251