Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410901198:

Variant ID: vg0410901198 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 10901198
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

GGCCAAAGAATACATCGAGTGAACGGAGGATCTACAAGATATTAAAGTCCAATGAGTTTTGGAACCCAATTCGGCCTCCGGAGACAGTACTGACTTCAAA[C/T]
GGACCTAGCGCCTTCATGCCAACTCCGATTTGGATGATCTTGGATTACATGGAAAGCTTATCTCGCTAGCTTTCAAACGCATCCAGTCTCATGTCCAAAT

Reverse complement sequence

ATTTGGACATGAGACTGGATGCGTTTGAAAGCTAGCGAGATAAGCTTTCCATGTAATCCAAGATCATCCAAATCGGAGTTGGCATGAAGGCGCTAGGTCC[G/A]
TTTGAAGTCAGTACTGTCTCCGGAGGCCGAATTGGGTTCCAAAACTCATTGGACTTTAATATCTTGTAGATCCTCCGTTCACTCGATGTATTCTTTGGCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.30%	28.70%	0.02%	0.00%	NA
All Indica	2759	57.00%	42.90%	0.04%	0.00%	NA
All Japonica	1512	99.10%	0.90%	0.00%	0.00%	NA
Aus	269	52.80%	47.20%	0.00%	0.00%	NA
Indica I	595	77.30%	22.70%	0.00%	0.00%	NA
Indica II	465	49.20%	50.80%	0.00%	0.00%	NA
Indica III	913	52.20%	47.80%	0.00%	0.00%	NA
Indica Intermediate	786	51.90%	48.00%	0.13%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	68.90%	31.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0410901198	C -> T	LOC_Os04g19580.1	upstream_gene_variant ; 682.0bp to feature; MODIFIER	silent_mutation	Average:35.643; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0410901198	C -> T	LOC_Os04g19590.1	upstream_gene_variant ; 4201.0bp to feature; MODIFIER	silent_mutation	Average:35.643; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0410901198	C -> T	LOC_Os04g19580-LOC_Os04g19590	intergenic_region ; MODIFIER	silent_mutation	Average:35.643; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0410901198	NA	3.18E-06	mr1062	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198	NA	4.78E-06	mr1386	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198	NA	6.53E-08	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198	NA	5.39E-07	mr1414	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198	NA	2.25E-06	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198	NA	2.17E-16	mr1830	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198	4.60E-06	6.06E-11	mr1830	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198	2.42E-08	1.24E-20	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198	1.13E-08	1.81E-16	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198	NA	1.29E-06	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198	NA	3.50E-07	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198	NA	1.08E-07	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198	NA	2.76E-06	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198	NA	2.22E-16	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198	NA	4.13E-14	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198	1.64E-09	3.93E-34	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410901198	1.04E-10	5.10E-31	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251