\
| Variant ID: vg0410821067 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10821067 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 74. )
TCAAACTGGTTGAACCTAGGAGCATACTGAGGCTGAGGCGATCCCCCCTGTTGATAGTGAACATGAGGTGAAGGGGGCTGGTATTGATAATTCAAGTTAC[T/C]
CCCTTGGTAGTTCTGGACATTCGGCTGAATATTACGCACTAACTGCTCAGGGATAACTTGGGCAGCAACCGATTGTCCGGTTGTACAACGTGTACCAGAT
ATCTGGTACACGTTGTACAACCGGACAATCGGTTGCTGCCCAAGTTATCCCTGAGCAGTTAGTGCGTAATATTCAGCCGAATGTCCAGAACTACCAAGGG[A/G]
GTAACTTGAATTATCAATACCAGCCCCCTTCACCTCATGTTCACTATCAACAGGGGGGATCGCCTCAGCCTCAGTATGCTCCTAGGTTCAACCAGTTTGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 23.60% | 15.10% | 1.02% | 60.33% | NA |
| All Indica | 2759 | 6.00% | 0.90% | 1.38% | 91.77% | NA |
| All Japonica | 1512 | 60.80% | 38.20% | 0.00% | 0.93% | NA |
| Aus | 269 | 1.10% | 0.00% | 3.35% | 95.54% | NA |
| Indica I | 595 | 2.20% | 0.20% | 0.84% | 96.81% | NA |
| Indica II | 465 | 23.00% | 1.70% | 2.15% | 73.12% | NA |
| Indica III | 913 | 1.00% | 0.40% | 0.99% | 97.59% | NA |
| Indica Intermediate | 786 | 4.60% | 1.40% | 1.78% | 92.24% | NA |
| Temperate Japonica | 767 | 95.80% | 3.70% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 4.00% | 94.80% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 68.50% | 29.90% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 1.00% | 85.40% | 0.00% | 13.54% | NA |
| Intermediate | 90 | 26.70% | 33.30% | 1.11% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410821067 | T -> C | LOC_Os04g19420.1 | missense_variant ; p.Ser292Gly; MODERATE | nonsynonymous_codon ; S292G | Average:19.024; most accessible tissue: Callus, score: 53.381 | possibly damaging |
-1.975 |
TOLERATED | 1.00 |
| vg0410821067 | T -> DEL | LOC_Os04g19420.1 | N | frameshift_variant | Average:19.024; most accessible tissue: Callus, score: 53.381 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410821067 | NA | 3.82E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410821067 | NA | 2.17E-06 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410821067 | NA | 3.42E-06 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410821067 | NA | 9.29E-08 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410821067 | NA | 4.91E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410821067 | NA | 5.73E-07 | mr1403 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410821067 | NA | 3.88E-11 | mr1454 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410821067 | 5.08E-08 | 5.07E-08 | mr1703 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410821067 | NA | 1.54E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410821067 | NA | 3.67E-07 | mr1715 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410821067 | NA | 3.57E-07 | mr1739 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410821067 | NA | 3.46E-13 | mr1789 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410821067 | NA | 2.12E-09 | mr1880 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410821067 | NA | 4.96E-08 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410821067 | NA | 4.24E-06 | mr1826_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |