Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410770678:

Variant ID: vg0410770678 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10770678
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTAGTGCTCGTCCATAAATTTCTCCATCGAGTCCTTGCAACATGTAAGCTCCCTTAGACACAACCTTATAGATTTGGAACGGTCCTTTCCAATTCGGC[G/A]
ACCACTTGCTGAATTTGTTATCCCAAGTCCCAATCAGCAAAATCAACTTCCATACATGTTCACCGTCCGAAAAAGTCTTGGGCACCACTTTCTTATTGTA

Reverse complement sequence

TACAATAAGAAAGTGGTGCCCAAGACTTTTTCGGACGGTGAACATGTATGGAAGTTGATTTTGCTGATTGGGACTTGGGATAACAAATTCAGCAAGTGGT[C/T]
GCCGAATTGGAAAGGACCGTTCCAAATCTATAAGGTTGTGTCTAAGGGAGCTTACATGTTGCAAGGACTCGATGGAGAAATTTATGGACGAGCACTAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.80% 3.40% 4.80% 0.00% NA
All Indica  2759 86.00% 5.70% 8.23% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 49.60% 20.80% 29.58% 0.00% NA
Indica II  465 97.20% 0.40% 2.37% 0.00% NA
Indica III  913 97.20% 1.50% 1.31% 0.00% NA
Indica Intermediate  786 94.10% 2.30% 3.56% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410770678 G -> A LOC_Os04g19360.1 missense_variant ; p.Ser1107Leu; MODERATE nonsynonymous_codon ; S1107L Average:28.691; most accessible tissue: Zhenshan97 young leaf, score: 49.329 probably damaging 2.029 TOLERATED 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410770678 NA 2.67E-07 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 NA 3.27E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 NA 5.82E-06 mr1284_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 1.67E-06 1.67E-06 mr1284_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 NA 7.48E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 9.86E-06 9.86E-06 mr1374_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 2.75E-06 2.75E-06 mr1412_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 2.49E-06 2.48E-06 mr1412_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 NA 6.47E-06 mr1556_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 NA 5.30E-07 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 NA 1.26E-07 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 NA 8.68E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 6.71E-06 6.71E-06 mr1665_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 5.98E-06 2.60E-08 mr1683_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 NA 3.59E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 NA 5.83E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 8.41E-06 8.41E-06 mr1764_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 1.52E-06 1.52E-06 mr1812_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 NA 1.82E-06 mr1823_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 NA 4.11E-06 mr1832_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 2.84E-06 2.84E-06 mr1832_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 NA 7.15E-06 mr1833_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 4.11E-06 4.11E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 NA 3.25E-08 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 NA 2.18E-06 mr1843_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 3.11E-06 3.11E-06 mr1843_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 5.57E-06 5.59E-06 mr1847_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 8.14E-06 8.14E-06 mr1847_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 NA 2.76E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410770678 NA 4.46E-06 mr1856_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251