\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410692283:

Variant ID: vg0410692283 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10692283
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:


CATCTCCTCTACCCTTGCCATGTTATGTCAGCTAGATTAGGTTATACTCTAGATTCAGCCTGGAGTCCATCTAGCCTGTGGTGAGTACGAGTATATCTTC[C/T]
AGGGATTCCCGAGAACCGGTCCTTAATTGTCATGGGCACGACTTCTAAAAATCATGCACGTACCCACAACCCACCATTAAAGCATATTTTTGTTTCATTA

Reverse complement sequence

TAATGAAACAAAAATATGCTTTAATGGTGGGTTGTGGGTACGTGCATGATTTTTAGAAGTCGTGCCCATGACAATTAAGGACCGGTTCTCGGGAATCCCT[G/A]
GAAGATATACTCGTACTCACCACAGGCTAGATGGACTCCAGGCTGAATCTAGAGTATAACCTAATCTAGCTGACATAACATGGCAAGGGTAGAGGAGATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.70% 1.60% 2.16% 9.54% NA
All Indica  2759 99.60% 0.00% 0.25% 0.14% NA
All Japonica  1512 64.00% 4.70% 2.78% 28.51% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 0.00% 0.43% 0.65% NA
Indica III  913 99.80% 0.00% 0.22% 0.00% NA
Indica Intermediate  786 99.50% 0.00% 0.38% 0.13% NA
Temperate Japonica  767 96.70% 0.00% 0.13% 3.13% NA
Tropical Japonica  504 9.90% 12.30% 6.94% 70.83% NA
Japonica Intermediate  241 73.00% 3.70% 2.49% 20.75% NA
VI/Aromatic  96 41.70% 3.10% 44.79% 10.42% NA
Intermediate  90 81.10% 1.10% 11.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410692283 C -> DEL N N silent_mutation Average:45.771; most accessible tissue: Zhenshan97 young leaf, score: 77.736 N N N N
vg0410692283 C -> T LOC_Os04g19250.1 downstream_gene_variant ; 2554.0bp to feature; MODIFIER silent_mutation Average:45.771; most accessible tissue: Zhenshan97 young leaf, score: 77.736 N N N N
vg0410692283 C -> T LOC_Os04g19250-LOC_Os04g19260 intergenic_region ; MODIFIER silent_mutation Average:45.771; most accessible tissue: Zhenshan97 young leaf, score: 77.736 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410692283 NA 1.08E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283 NA 5.54E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283 NA 1.24E-06 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283 NA 1.65E-06 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283 NA 3.46E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283 NA 5.41E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283 NA 9.73E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283 NA 2.66E-07 mr1470_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283 4.48E-06 4.48E-06 mr1470_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283 NA 2.94E-06 mr1689_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283 NA 2.81E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283 NA 2.81E-09 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251