Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410692283:

Variant ID: vg0410692283 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 10692283
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:

CATCTCCTCTACCCTTGCCATGTTATGTCAGCTAGATTAGGTTATACTCTAGATTCAGCCTGGAGTCCATCTAGCCTGTGGTGAGTACGAGTATATCTTC[C/T]
AGGGATTCCCGAGAACCGGTCCTTAATTGTCATGGGCACGACTTCTAAAAATCATGCACGTACCCACAACCCACCATTAAAGCATATTTTTGTTTCATTA

Reverse complement sequence

TAATGAAACAAAAATATGCTTTAATGGTGGGTTGTGGGTACGTGCATGATTTTTAGAAGTCGTGCCCATGACAATTAAGGACCGGTTCTCGGGAATCCCT[G/A]
GAAGATATACTCGTACTCACCACAGGCTAGATGGACTCCAGGCTGAATCTAGAGTATAACCTAATCTAGCTGACATAACATGGCAAGGGTAGAGGAGATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.70%	1.60%	2.16%	9.54%	NA
All Indica	2759	99.60%	0.00%	0.25%	0.14%	NA
All Japonica	1512	64.00%	4.70%	2.78%	28.51%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.90%	0.00%	0.43%	0.65%	NA
Indica III	913	99.80%	0.00%	0.22%	0.00%	NA
Indica Intermediate	786	99.50%	0.00%	0.38%	0.13%	NA
Temperate Japonica	767	96.70%	0.00%	0.13%	3.13%	NA
Tropical Japonica	504	9.90%	12.30%	6.94%	70.83%	NA
Japonica Intermediate	241	73.00%	3.70%	2.49%	20.75%	NA
VI/Aromatic	96	41.70%	3.10%	44.79%	10.42%	NA
Intermediate	90	81.10%	1.10%	11.11%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0410692283	C -> DEL	N	N	silent_mutation	Average:45.771; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N
vg0410692283	C -> T	LOC_Os04g19250.1	downstream_gene_variant ; 2554.0bp to feature; MODIFIER	silent_mutation	Average:45.771; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N
vg0410692283	C -> T	LOC_Os04g19250-LOC_Os04g19260	intergenic_region ; MODIFIER	silent_mutation	Average:45.771; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0410692283	NA	1.08E-09	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283	NA	5.54E-07	mr1243_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283	NA	1.24E-06	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283	NA	1.65E-06	mr1257_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283	NA	3.46E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283	NA	5.41E-07	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283	NA	9.73E-07	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283	NA	2.66E-07	mr1470_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283	4.48E-06	4.48E-06	mr1470_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283	NA	2.94E-06	mr1689_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283	NA	2.81E-10	mr1784_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410692283	NA	2.81E-09	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251