\
| Variant ID: vg0410692283 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10692283 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 327. )
CATCTCCTCTACCCTTGCCATGTTATGTCAGCTAGATTAGGTTATACTCTAGATTCAGCCTGGAGTCCATCTAGCCTGTGGTGAGTACGAGTATATCTTC[C/T]
AGGGATTCCCGAGAACCGGTCCTTAATTGTCATGGGCACGACTTCTAAAAATCATGCACGTACCCACAACCCACCATTAAAGCATATTTTTGTTTCATTA
TAATGAAACAAAAATATGCTTTAATGGTGGGTTGTGGGTACGTGCATGATTTTTAGAAGTCGTGCCCATGACAATTAAGGACCGGTTCTCGGGAATCCCT[G/A]
GAAGATATACTCGTACTCACCACAGGCTAGATGGACTCCAGGCTGAATCTAGAGTATAACCTAATCTAGCTGACATAACATGGCAAGGGTAGAGGAGATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.70% | 1.60% | 2.16% | 9.54% | NA |
| All Indica | 2759 | 99.60% | 0.00% | 0.25% | 0.14% | NA |
| All Japonica | 1512 | 64.00% | 4.70% | 2.78% | 28.51% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.00% | 0.43% | 0.65% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.00% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 96.70% | 0.00% | 0.13% | 3.13% | NA |
| Tropical Japonica | 504 | 9.90% | 12.30% | 6.94% | 70.83% | NA |
| Japonica Intermediate | 241 | 73.00% | 3.70% | 2.49% | 20.75% | NA |
| VI/Aromatic | 96 | 41.70% | 3.10% | 44.79% | 10.42% | NA |
| Intermediate | 90 | 81.10% | 1.10% | 11.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410692283 | C -> DEL | N | N | silent_mutation | Average:45.771; most accessible tissue: Zhenshan97 young leaf, score: 77.736 | N | N | N | N |
| vg0410692283 | C -> T | LOC_Os04g19250.1 | downstream_gene_variant ; 2554.0bp to feature; MODIFIER | silent_mutation | Average:45.771; most accessible tissue: Zhenshan97 young leaf, score: 77.736 | N | N | N | N |
| vg0410692283 | C -> T | LOC_Os04g19250-LOC_Os04g19260 | intergenic_region ; MODIFIER | silent_mutation | Average:45.771; most accessible tissue: Zhenshan97 young leaf, score: 77.736 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410692283 | NA | 1.08E-09 | mr1235_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410692283 | NA | 5.54E-07 | mr1243_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410692283 | NA | 1.24E-06 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410692283 | NA | 1.65E-06 | mr1257_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410692283 | NA | 3.46E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410692283 | NA | 5.41E-07 | mr1363_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410692283 | NA | 9.73E-07 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410692283 | NA | 2.66E-07 | mr1470_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410692283 | 4.48E-06 | 4.48E-06 | mr1470_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410692283 | NA | 2.94E-06 | mr1689_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410692283 | NA | 2.81E-10 | mr1784_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410692283 | NA | 2.81E-09 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |