\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410681849:

Variant ID: vg0410681849 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10681849
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCAAGAGTCGGCTAAAGTCCGAATCGGCTACGATAAGGATCGGCAGGGTTCGAGTCGGACAAGGTTGGCCGATTAAGCCGATTCTGACAATGTGACTC[G/T]
GTACACGTTGTCGGGTTGAGTTAATGTGCTTCATGAGGATTGCCATGCACGGATTGAGTCCTGAAAAGCCAATTGTATCTATTAATTAGGGTATTTCATG

Reverse complement sequence

CATGAAATACCCTAATTAATAGATACAATTGGCTTTTCAGGACTCAATCCGTGCATGGCAATCCTCATGAAGCACATTAACTCAACCCGACAACGTGTAC[C/A]
GAGTCACATTGTCAGAATCGGCTTAATCGGCCAACCTTGTCCGACTCGAACCCTGCCGATCCTTATCGTAGCCGATTCGGACTTTAGCCGACTCTTGCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.00% 10.40% 0.59% 0.00% NA
All Indica  2759 99.60% 0.40% 0.07% 0.00% NA
All Japonica  1512 67.80% 30.70% 1.52% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.70% 0.90% 0.43% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 97.90% 1.60% 0.52% 0.00% NA
Tropical Japonica  504 17.30% 79.40% 3.37% 0.00% NA
Japonica Intermediate  241 77.60% 21.60% 0.83% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 83.30% 13.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410681849 G -> T LOC_Os04g19240.1 upstream_gene_variant ; 1240.0bp to feature; MODIFIER silent_mutation Average:33.434; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N
vg0410681849 G -> T LOC_Os04g19210.1 downstream_gene_variant ; 4824.0bp to feature; MODIFIER silent_mutation Average:33.434; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N
vg0410681849 G -> T LOC_Os04g19220.1 downstream_gene_variant ; 3028.0bp to feature; MODIFIER silent_mutation Average:33.434; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N
vg0410681849 G -> T LOC_Os04g19230.1 downstream_gene_variant ; 1162.0bp to feature; MODIFIER silent_mutation Average:33.434; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N
vg0410681849 G -> T LOC_Os04g19230-LOC_Os04g19240 intergenic_region ; MODIFIER silent_mutation Average:33.434; most accessible tissue: Zhenshan97 young leaf, score: 51.334 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410681849 2.58E-14 1.64E-32 mr1301 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849 3.42E-08 4.63E-21 mr1301 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849 8.28E-11 1.10E-20 mr1410 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849 NA 1.16E-14 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849 NA 1.81E-08 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849 NA 1.68E-09 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849 NA 4.52E-29 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849 NA 7.25E-19 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849 NA 2.04E-12 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849 NA 5.78E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849 NA 1.16E-08 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849 NA 1.07E-09 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849 NA 1.98E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849 2.84E-13 6.34E-32 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849 2.25E-08 2.42E-22 mr1301_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849 8.25E-10 1.30E-20 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849 NA 8.02E-14 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849 NA 4.72E-08 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849 NA 4.42E-06 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849 1.67E-06 2.07E-14 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849 NA 1.37E-14 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251