Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410681849:

Variant ID: vg0410681849 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 10681849
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:

GAGCAAGAGTCGGCTAAAGTCCGAATCGGCTACGATAAGGATCGGCAGGGTTCGAGTCGGACAAGGTTGGCCGATTAAGCCGATTCTGACAATGTGACTC[G/T]
GTACACGTTGTCGGGTTGAGTTAATGTGCTTCATGAGGATTGCCATGCACGGATTGAGTCCTGAAAAGCCAATTGTATCTATTAATTAGGGTATTTCATG

Reverse complement sequence

CATGAAATACCCTAATTAATAGATACAATTGGCTTTTCAGGACTCAATCCGTGCATGGCAATCCTCATGAAGCACATTAACTCAACCCGACAACGTGTAC[C/A]
GAGTCACATTGTCAGAATCGGCTTAATCGGCCAACCTTGTCCGACTCGAACCCTGCCGATCCTTATCGTAGCCGATTCGGACTTTAGCCGACTCTTGCTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.00%	10.40%	0.59%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.07%	0.00%	NA
All Japonica	1512	67.80%	30.70%	1.52%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.70%	0.90%	0.43%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	97.90%	1.60%	0.52%	0.00%	NA
Tropical Japonica	504	17.30%	79.40%	3.37%	0.00%	NA
Japonica Intermediate	241	77.60%	21.60%	0.83%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	83.30%	13.30%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0410681849	G -> T	LOC_Os04g19240.1	upstream_gene_variant ; 1240.0bp to feature; MODIFIER	silent_mutation	Average:33.434; most accessible tissue: Zhenshan97 young leaf, score: 51.334	N	N	N	N
vg0410681849	G -> T	LOC_Os04g19210.1	downstream_gene_variant ; 4824.0bp to feature; MODIFIER	silent_mutation	Average:33.434; most accessible tissue: Zhenshan97 young leaf, score: 51.334	N	N	N	N
vg0410681849	G -> T	LOC_Os04g19220.1	downstream_gene_variant ; 3028.0bp to feature; MODIFIER	silent_mutation	Average:33.434; most accessible tissue: Zhenshan97 young leaf, score: 51.334	N	N	N	N
vg0410681849	G -> T	LOC_Os04g19230.1	downstream_gene_variant ; 1162.0bp to feature; MODIFIER	silent_mutation	Average:33.434; most accessible tissue: Zhenshan97 young leaf, score: 51.334	N	N	N	N
vg0410681849	G -> T	LOC_Os04g19230-LOC_Os04g19240	intergenic_region ; MODIFIER	silent_mutation	Average:33.434; most accessible tissue: Zhenshan97 young leaf, score: 51.334	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0410681849	2.58E-14	1.64E-32	mr1301	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849	3.42E-08	4.63E-21	mr1301	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849	8.28E-11	1.10E-20	mr1410	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849	NA	1.16E-14	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849	NA	1.81E-08	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849	NA	1.68E-09	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849	NA	4.52E-29	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849	NA	7.25E-19	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849	NA	2.04E-12	mr1864	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849	NA	5.78E-10	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849	NA	1.16E-08	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849	NA	1.07E-09	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849	NA	1.98E-07	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849	2.84E-13	6.34E-32	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849	2.25E-08	2.42E-22	mr1301_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849	8.25E-10	1.30E-20	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849	NA	8.02E-14	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849	NA	4.72E-08	mr1733_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849	NA	4.42E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849	1.67E-06	2.07E-14	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410681849	NA	1.37E-14	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251