| Variant ID: vg0410543813 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10543813 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTTGTGCATGAATGATCCTCCAACGGTTATGCCCATATAGAATGCATACTCCTTATCCAAACCCGTATGGAAATGTTGGAGAAGGACATACTCGGGTAA[G/A]
GACAGGGTTGGACCGGACTGCACTAAATTAGTGAATCTGGACCAAGCTGCACCGATTGATTCGTTTTCGATCTGCTTGTTGGTATTTAATATGGTCACAT
ATGTGACCATATTAAATACCAACAAGCAGATCGAAAACGAATCAATCGGTGCAGCTTGGTCCAGATTCACTAATTTAGTGCAGTCCGGTCCAACCCTGTC[C/T]
TTACCCGAGTATGTCCTTCTCCAACATTTCCATACGGGTTTGGATAAGGAGTATGCATTCTATATGGGCATAACCGTTGGAGGATCATTCATGCACAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.20% | 11.80% | 0.85% | 54.17% | NA |
| All Indica | 2759 | 16.70% | 0.50% | 1.34% | 81.41% | NA |
| All Japonica | 1512 | 64.50% | 34.40% | 0.00% | 1.12% | NA |
| Aus | 269 | 5.20% | 0.00% | 1.12% | 93.68% | NA |
| Indica I | 595 | 27.70% | 0.20% | 1.01% | 71.09% | NA |
| Indica II | 465 | 28.80% | 1.30% | 2.58% | 67.31% | NA |
| Indica III | 913 | 2.60% | 0.30% | 0.77% | 96.28% | NA |
| Indica Intermediate | 786 | 17.60% | 0.60% | 1.53% | 80.28% | NA |
| Temperate Japonica | 767 | 97.50% | 2.30% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 10.50% | 87.10% | 0.00% | 2.38% | NA |
| Japonica Intermediate | 241 | 72.20% | 26.10% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 81.20% | 6.20% | 0.00% | 12.50% | NA |
| Intermediate | 90 | 44.40% | 18.90% | 0.00% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410543813 | G -> DEL | LOC_Os04g18980.1 | N | frameshift_variant | Average:11.184; most accessible tissue: Callus, score: 48.84 | N | N | N | N |
| vg0410543813 | G -> A | LOC_Os04g18980.1 | synonymous_variant ; p.Ser1577Ser; LOW | synonymous_codon | Average:11.184; most accessible tissue: Callus, score: 48.84 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410543813 | NA | 2.02E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410543813 | NA | 4.81E-09 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410543813 | NA | 6.74E-08 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410543813 | NA | 2.00E-22 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410543813 | NA | 1.33E-16 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410543813 | NA | 9.13E-07 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410543813 | NA | 9.34E-07 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410543813 | NA | 1.03E-13 | mr1454 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410543813 | NA | 2.71E-11 | mr1454 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410543813 | NA | 2.15E-08 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/