\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410543704:

Variant ID: vg0410543704 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10543704
Reference Allele: TAlternative Allele: C,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, C: 0.31, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GGCTCCTCTATCTTCGACACAGATGCCTCCGGCTGGGGTTCCTTGGGTTGCGTCATGAAGGAAGTGTTTTCTAGAATGCGATCCAAAATTGTCCTTCCTT[T/C,G]
TGATAGCGTTTTGTGCATGAATGATCCTCCAACGGTTATGCCCATATAGAATGCATACTCCTTATCCAAACCCGTATGGAAATGTTGGAGAAGGACATAC

Reverse complement sequence

GTATGTCCTTCTCCAACATTTCCATACGGGTTTGGATAAGGAGTATGCATTCTATATGGGCATAACCGTTGGAGGATCATTCATGCACAAAACGCTATCA[A/G,C]
AAGGAAGGACAATTTTGGATCGCATTCTAGAAAACACTTCCTTCATGACGCAACCCAAGGAACCCCAGCCGGAGGCATCTGTGTCGAAGATAGAGGAGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.20% 17.60% 0.76% 54.42% G: 0.04%
All Indica  2759 11.60% 5.20% 1.16% 81.95% G: 0.07%
All Japonica  1512 61.00% 37.80% 0.00% 1.19% NA
Aus  269 5.90% 0.00% 1.49% 92.57% NA
Indica I  595 27.20% 0.30% 0.67% 71.76% NA
Indica II  465 7.70% 22.60% 1.08% 68.60% NA
Indica III  913 1.20% 1.00% 0.99% 96.60% G: 0.22%
Indica Intermediate  786 14.20% 3.40% 1.78% 80.53% NA
Temperate Japonica  767 96.10% 3.70% 0.00% 0.26% NA
Tropical Japonica  504 4.20% 93.50% 0.00% 2.38% NA
Japonica Intermediate  241 68.00% 30.30% 0.00% 1.66% NA
VI/Aromatic  96 2.10% 86.50% 0.00% 11.46% NA
Intermediate  90 27.80% 35.60% 0.00% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410543704 T -> C LOC_Os04g18980.1 missense_variant ; p.Lys1614Glu; MODERATE nonsynonymous_codon ; K1614E Average:11.119; most accessible tissue: Callus, score: 48.84 benign -1.296 TOLERATED 1.00
vg0410543704 T -> DEL LOC_Os04g18980.1 N frameshift_variant Average:11.119; most accessible tissue: Callus, score: 48.84 N N N N
vg0410543704 T -> G LOC_Os04g18980.1 missense_variant ; p.Lys1614Gln; MODERATE nonsynonymous_codon ; K1614Q Average:11.119; most accessible tissue: Callus, score: 48.84 benign -0.808 DELETERIOUS 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410543704 NA 3.82E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410543704 NA 2.17E-06 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410543704 NA 3.42E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410543704 NA 8.01E-06 mr1171 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410543704 NA 9.29E-08 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410543704 NA 2.78E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410543704 NA 4.91E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410543704 NA 5.62E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410543704 NA 5.73E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410543704 NA 3.88E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410543704 NA 3.88E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410543704 NA 5.63E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410543704 NA 3.67E-07 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410543704 NA 3.57E-07 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410543704 NA 3.46E-13 mr1789 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410543704 NA 6.15E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410543704 NA 2.12E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410543704 NA 1.93E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410543704 1.87E-06 NA mr1563_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410543704 NA 2.14E-13 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251