Variant ID: vg0410520697 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 10520697 |
Reference Allele: G | Alternative Allele: C |
Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AGGTCCGGCCGCCATCAATGGCGCCGGCGAGATTTGCGGGGGCAAATCCGCCCGTTTGAACGCGAGAGAGAGAGAGGGAAAAATGGGGGGAAAGGGAGAG[G/C]
GGATCACGGGGAGTGATTCCCCCCACTTTATTGCACGCGGGGACGGCGGGAGGCGGCGGGATTCGCGGTGGCGGTGGCGCTAGGGCGCGGGGGAGGTGGC
GCCACCTCCCCCGCGCCCTAGCGCCACCGCCACCGCGAATCCCGCCGCCTCCCGCCGTCCCCGCGTGCAATAAAGTGGGGGGAATCACTCCCCGTGATCC[C/G]
CTCTCCCTTTCCCCCCATTTTTCCCTCTCTCTCTCTCGCGTTCAAACGGGCGGATTTGCCCCCGCAAATCTCGCCGGCGCCATTGATGGCGGCCGGACCT
Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 18.60% | 1.70% | 15.89% | 63.80% | NA |
All Indica | 2759 | 3.70% | 0.00% | 10.87% | 85.47% | NA |
All Japonica | 1512 | 50.00% | 5.20% | 20.17% | 24.67% | NA |
Aus | 269 | 0.70% | 0.00% | 20.82% | 78.44% | NA |
Indica I | 595 | 8.70% | 0.00% | 16.64% | 74.62% | NA |
Indica II | 465 | 2.20% | 0.00% | 16.77% | 81.08% | NA |
Indica III | 913 | 0.30% | 0.00% | 3.72% | 95.95% | NA |
Indica Intermediate | 786 | 4.60% | 0.00% | 11.32% | 84.10% | NA |
Temperate Japonica | 767 | 76.80% | 8.90% | 10.69% | 3.65% | NA |
Tropical Japonica | 504 | 2.40% | 1.40% | 37.90% | 58.33% | NA |
Japonica Intermediate | 241 | 64.30% | 1.20% | 13.28% | 21.16% | NA |
VI/Aromatic | 96 | 0.00% | 0.00% | 68.75% | 31.25% | NA |
Intermediate | 90 | 22.20% | 3.30% | 26.67% | 47.78% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0410520697 | G -> C | LOC_Os04g18910.1 | downstream_gene_variant ; 3703.0bp to feature; MODIFIER | silent_mutation | Average:21.835; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
vg0410520697 | G -> C | LOC_Os04g18920.1 | downstream_gene_variant ; 354.0bp to feature; MODIFIER | silent_mutation | Average:21.835; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
vg0410520697 | G -> C | LOC_Os04g18930.1 | downstream_gene_variant ; 3879.0bp to feature; MODIFIER | silent_mutation | Average:21.835; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
vg0410520697 | G -> C | LOC_Os04g18910-LOC_Os04g18920 | intergenic_region ; MODIFIER | silent_mutation | Average:21.835; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
vg0410520697 | G -> DEL | N | N | silent_mutation | Average:21.835; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0410520697 | NA | 3.16E-06 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0410520697 | 1.19E-06 | 2.90E-12 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0410520697 | 6.55E-09 | 6.55E-09 | mr1525 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0410520697 | NA | 4.41E-08 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0410520697 | NA | 3.48E-08 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/