Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410520697:

Variant ID: vg0410520697 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 10520697
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGTCCGGCCGCCATCAATGGCGCCGGCGAGATTTGCGGGGGCAAATCCGCCCGTTTGAACGCGAGAGAGAGAGAGGGAAAAATGGGGGGAAAGGGAGAG[G/C]
GGATCACGGGGAGTGATTCCCCCCACTTTATTGCACGCGGGGACGGCGGGAGGCGGCGGGATTCGCGGTGGCGGTGGCGCTAGGGCGCGGGGGAGGTGGC

Reverse complement sequence

GCCACCTCCCCCGCGCCCTAGCGCCACCGCCACCGCGAATCCCGCCGCCTCCCGCCGTCCCCGCGTGCAATAAAGTGGGGGGAATCACTCCCCGTGATCC[C/G]
CTCTCCCTTTCCCCCCATTTTTCCCTCTCTCTCTCTCGCGTTCAAACGGGCGGATTTGCCCCCGCAAATCTCGCCGGCGCCATTGATGGCGGCCGGACCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	18.60%	1.70%	15.89%	63.80%	NA
All Indica	2759	3.70%	0.00%	10.87%	85.47%	NA
All Japonica	1512	50.00%	5.20%	20.17%	24.67%	NA
Aus	269	0.70%	0.00%	20.82%	78.44%	NA
Indica I	595	8.70%	0.00%	16.64%	74.62%	NA
Indica II	465	2.20%	0.00%	16.77%	81.08%	NA
Indica III	913	0.30%	0.00%	3.72%	95.95%	NA
Indica Intermediate	786	4.60%	0.00%	11.32%	84.10%	NA
Temperate Japonica	767	76.80%	8.90%	10.69%	3.65%	NA
Tropical Japonica	504	2.40%	1.40%	37.90%	58.33%	NA
Japonica Intermediate	241	64.30%	1.20%	13.28%	21.16%	NA
VI/Aromatic	96	0.00%	0.00%	68.75%	31.25%	NA
Intermediate	90	22.20%	3.30%	26.67%	47.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0410520697	G -> C	LOC_Os04g18910.1	downstream_gene_variant ; 3703.0bp to feature; MODIFIER	silent_mutation	Average:21.835; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N
vg0410520697	G -> C	LOC_Os04g18920.1	downstream_gene_variant ; 354.0bp to feature; MODIFIER	silent_mutation	Average:21.835; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N
vg0410520697	G -> C	LOC_Os04g18930.1	downstream_gene_variant ; 3879.0bp to feature; MODIFIER	silent_mutation	Average:21.835; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N
vg0410520697	G -> C	LOC_Os04g18910-LOC_Os04g18920	intergenic_region ; MODIFIER	silent_mutation	Average:21.835; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N
vg0410520697	G -> DEL	N	N	silent_mutation	Average:21.835; most accessible tissue: Minghui63 root, score: 43.505	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0410520697	NA	3.16E-06	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410520697	1.19E-06	2.90E-12	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410520697	6.55E-09	6.55E-09	mr1525	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410520697	NA	4.41E-08	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410520697	NA	3.48E-08	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251