RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0410515163:

Variant ID: vg0410515163 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 10515163
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCTGATCCAAAGAAGGGTTTCCAAGTGTATTGCGATGCATCCAAACTTGGGTTAGGTTGTGTTCTGATGCAAGATGGGAAGGTGGTTGCCTATGCATCT[C/T]
GTCAGAAGAACTACCCTACTCATGATCTTGAGTTAGCTGCCGTGGTTCATGCGTTGAAGATTTGGCGTCATTATCTTTTCGGTACTCGTACAGAGGTGTA

Reverse complement sequence

TACACCTCTGTACGAGTACCGAAAAGATAATGACGCCAAATCTTCAACGCATGAACCACGGCAGCTAACTCAAGATCATGAGTAGGGTAGTTCTTCTGAC[G/A]
AGATGCATAGGCAACCACCTTCCCATCTTGCATCAGAACACAACCTAACCCAAGTTTGGATGCATCGCAATACACTTGGAAACCCTTCTTTGGATCAGGT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	20.80%	1.80%	12.17%	65.19%	NA
All Indica	2759	5.70%	0.10%	11.60%	82.64%	NA
All Japonica	1512	53.20%	5.40%	10.65%	30.82%	NA
Aus	269	1.50%	0.00%	7.06%	91.45%	NA
Indica I	595	10.80%	0.00%	20.34%	68.91%	NA
Indica II	465	7.30%	0.00%	10.54%	82.15%	NA
Indica III	913	1.00%	0.00%	4.16%	94.85%	NA
Indica Intermediate	786	6.20%	0.40%	14.25%	79.13%	NA
Temperate Japonica	767	82.30%	9.10%	5.08%	3.52%	NA
Tropical Japonica	504	3.00%	1.60%	20.04%	75.40%	NA
Japonica Intermediate	241	65.60%	1.20%	8.71%	24.48%	NA
VI/Aromatic	96	1.00%	0.00%	54.17%	44.79%	NA
Intermediate	90	21.10%	2.20%	25.56%	51.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0410515163	C -> DEL	LOC_Os04g18910.1	N	frameshift_variant	Average:5.754; most accessible tissue: Minghui63 flower, score: 9.27	N	N	N	N
vg0410515163	C -> T	LOC_Os04g18910.1	missense_variant ; p.Arg399Cys; MODERATE	nonsynonymous_codon ; R399C	Average:5.754; most accessible tissue: Minghui63 flower, score: 9.27	probably damaging	3.425	DELETERIOUS	0.01

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0410515163	NA	4.21E-06	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410515163	5.76E-10	3.16E-15	mr1062	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410515163	1.91E-08	1.91E-08	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410515163	7.41E-07	4.26E-10	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410515163	NA	1.43E-08	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 5 of 5 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0410515163:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact