\
| Variant ID: vg0410515163 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10515163 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACCTGATCCAAAGAAGGGTTTCCAAGTGTATTGCGATGCATCCAAACTTGGGTTAGGTTGTGTTCTGATGCAAGATGGGAAGGTGGTTGCCTATGCATCT[C/T]
GTCAGAAGAACTACCCTACTCATGATCTTGAGTTAGCTGCCGTGGTTCATGCGTTGAAGATTTGGCGTCATTATCTTTTCGGTACTCGTACAGAGGTGTA
TACACCTCTGTACGAGTACCGAAAAGATAATGACGCCAAATCTTCAACGCATGAACCACGGCAGCTAACTCAAGATCATGAGTAGGGTAGTTCTTCTGAC[G/A]
AGATGCATAGGCAACCACCTTCCCATCTTGCATCAGAACACAACCTAACCCAAGTTTGGATGCATCGCAATACACTTGGAAACCCTTCTTTGGATCAGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 20.80% | 1.80% | 12.17% | 65.19% | NA |
| All Indica | 2759 | 5.70% | 0.10% | 11.60% | 82.64% | NA |
| All Japonica | 1512 | 53.20% | 5.40% | 10.65% | 30.82% | NA |
| Aus | 269 | 1.50% | 0.00% | 7.06% | 91.45% | NA |
| Indica I | 595 | 10.80% | 0.00% | 20.34% | 68.91% | NA |
| Indica II | 465 | 7.30% | 0.00% | 10.54% | 82.15% | NA |
| Indica III | 913 | 1.00% | 0.00% | 4.16% | 94.85% | NA |
| Indica Intermediate | 786 | 6.20% | 0.40% | 14.25% | 79.13% | NA |
| Temperate Japonica | 767 | 82.30% | 9.10% | 5.08% | 3.52% | NA |
| Tropical Japonica | 504 | 3.00% | 1.60% | 20.04% | 75.40% | NA |
| Japonica Intermediate | 241 | 65.60% | 1.20% | 8.71% | 24.48% | NA |
| VI/Aromatic | 96 | 1.00% | 0.00% | 54.17% | 44.79% | NA |
| Intermediate | 90 | 21.10% | 2.20% | 25.56% | 51.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410515163 | C -> DEL | LOC_Os04g18910.1 | N | frameshift_variant | Average:5.754; most accessible tissue: Minghui63 flower, score: 9.27 | N | N | N | N |
| vg0410515163 | C -> T | LOC_Os04g18910.1 | missense_variant ; p.Arg399Cys; MODERATE | nonsynonymous_codon ; R399C | Average:5.754; most accessible tissue: Minghui63 flower, score: 9.27 | probably damaging |
3.425 |
DELETERIOUS | 0.01 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410515163 | NA | 4.21E-06 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410515163 | 5.76E-10 | 3.16E-15 | mr1062 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410515163 | 1.91E-08 | 1.91E-08 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410515163 | 7.41E-07 | 4.26E-10 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410515163 | NA | 1.43E-08 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |