\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410495105:

Variant ID: vg0410495105 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10495105
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGATATAGATTATCTTTTGTAACACGGACTCCTTCCCATATATAAGGGGGGTCCGGGTGCCTCTAGGGGCAGAGGTTGATTTTCTCCAAATCATACAA[C/T]
CAATAAGACACTCGGCGGATTCATCCCCGGACAGGAGTAGGGTATTACTTCTTGAATAAGAAGGCCTGAACCTGTATAAATCTTTTGTCTCCAAACCCAT

Reverse complement sequence

ATGGGTTTGGAGACAAAAGATTTATACAGGTTCAGGCCTTCTTATTCAAGAAGTAATACCCTACTCCTGTCCGGGGATGAATCCGCCGAGTGTCTTATTG[G/A]
TTGTATGATTTGGAGAAAATCAACCTCTGCCCCTAGAGGCACCCGGACCCCCCTTATATATGGGAAGGAGTCCGTGTTACAAAAGATAATCTATATCCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.40% 6.60% 12.23% 56.73% NA
All Indica  2759 7.30% 0.60% 4.57% 87.53% NA
All Japonica  1512 61.00% 17.90% 16.53% 4.63% NA
Aus  269 1.50% 5.20% 44.98% 48.33% NA
Indica I  595 18.00% 0.00% 1.34% 80.67% NA
Indica II  465 3.40% 0.40% 6.67% 89.46% NA
Indica III  913 0.90% 0.40% 5.91% 92.77% NA
Indica Intermediate  786 9.00% 1.30% 4.20% 85.50% NA
Temperate Japonica  767 96.00% 1.40% 1.56% 1.04% NA
Tropical Japonica  504 4.00% 44.00% 41.27% 10.71% NA
Japonica Intermediate  241 68.90% 15.40% 12.45% 3.32% NA
VI/Aromatic  96 0.00% 4.20% 63.54% 32.29% NA
Intermediate  90 27.80% 11.10% 22.22% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410495105 C -> DEL N N silent_mutation Average:14.963; most accessible tissue: Minghui63 root, score: 23.574 N N N N
vg0410495105 C -> T LOC_Os04g18860.1 upstream_gene_variant ; 1303.0bp to feature; MODIFIER silent_mutation Average:14.963; most accessible tissue: Minghui63 root, score: 23.574 N N N N
vg0410495105 C -> T LOC_Os04g18870.1 upstream_gene_variant ; 4844.0bp to feature; MODIFIER silent_mutation Average:14.963; most accessible tissue: Minghui63 root, score: 23.574 N N N N
vg0410495105 C -> T LOC_Os04g18850.1 downstream_gene_variant ; 4544.0bp to feature; MODIFIER silent_mutation Average:14.963; most accessible tissue: Minghui63 root, score: 23.574 N N N N
vg0410495105 C -> T LOC_Os04g18860-LOC_Os04g18870 intergenic_region ; MODIFIER silent_mutation Average:14.963; most accessible tissue: Minghui63 root, score: 23.574 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410495105 NA 2.28E-07 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410495105 NA 9.13E-07 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410495105 NA 4.37E-09 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410495105 NA 3.95E-07 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410495105 NA 1.78E-06 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410495105 NA 2.19E-09 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410495105 NA 1.00E-08 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410495105 NA 1.03E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410495105 NA 1.70E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410495105 NA 9.24E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410495105 NA 3.11E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410495105 NA 1.00E-12 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410495105 NA 2.38E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410495105 NA 1.70E-07 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410495105 NA 3.28E-09 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410495105 NA 9.76E-07 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410495105 NA 1.86E-12 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410495105 NA 9.94E-08 mr1844 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410495105 NA 4.93E-11 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410495105 NA 5.28E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251