\
| Variant ID: vg0410451065 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10451065 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 124. )
GGTTGAGGACTCCTAGACGGCTAGGTGTCACTCCCGAGCCACCGATCTACGTGTGGTTGGCCGAGAGAAGTTTGTGAAGGCCGGATCTCGCCTCCGCAAG[G/A]
AAAGAGATACCCCTTAGTGGAAGGAGGAGTGCTTAGTGCAACCTCTTGAGGAAAGGGTTAGCAAAGACCCGGCTCTTAGTGAGCTCCTCAACGGAGAGTA
TACTCTCCGTTGAGGAGCTCACTAAGAGCCGGGTCTTTGCTAACCCTTTCCTCAAGAGGTTGCACTAAGCACTCCTCCTTCCACTAAGGGGTATCTCTTT[C/T]
CTTGCGGAGGCGAGATCCGGCCTTCACAAACTTCTCTCGGCCAACCACACGTAGATCGGTGGCTCGGGAGTGACACCTAGCCGTCTAGGAGTCCTCAACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.30% | 27.30% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 53.20% | 46.40% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 23.50% | 76.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 74.00% | 25.20% | 0.86% | 0.00% | NA |
| Indica III | 913 | 59.00% | 41.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 56.60% | 42.50% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 10.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410451065 | G -> A | LOC_Os04g18800.1 | upstream_gene_variant ; 2933.0bp to feature; MODIFIER | silent_mutation | Average:38.322; most accessible tissue: Zhenshan97 flower, score: 58.632 | N | N | N | N |
| vg0410451065 | G -> A | LOC_Os04g18790.1 | downstream_gene_variant ; 1200.0bp to feature; MODIFIER | silent_mutation | Average:38.322; most accessible tissue: Zhenshan97 flower, score: 58.632 | N | N | N | N |
| vg0410451065 | G -> A | LOC_Os04g18780-LOC_Os04g18790 | intergenic_region ; MODIFIER | silent_mutation | Average:38.322; most accessible tissue: Zhenshan97 flower, score: 58.632 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410451065 | NA | 6.13E-09 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410451065 | 7.55E-06 | 1.31E-07 | mr1304_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410451065 | NA | 8.98E-06 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410451065 | NA | 3.43E-06 | mr1641_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410451065 | NA | 7.29E-06 | mr1696_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410451065 | 3.50E-06 | NA | mr1830_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410451065 | NA | 5.27E-11 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410451065 | 1.98E-09 | 3.94E-13 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410451065 | 5.44E-08 | 7.36E-21 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |