\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410451065:

Variant ID: vg0410451065 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10451065
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTGAGGACTCCTAGACGGCTAGGTGTCACTCCCGAGCCACCGATCTACGTGTGGTTGGCCGAGAGAAGTTTGTGAAGGCCGGATCTCGCCTCCGCAAG[G/A]
AAAGAGATACCCCTTAGTGGAAGGAGGAGTGCTTAGTGCAACCTCTTGAGGAAAGGGTTAGCAAAGACCCGGCTCTTAGTGAGCTCCTCAACGGAGAGTA

Reverse complement sequence

TACTCTCCGTTGAGGAGCTCACTAAGAGCCGGGTCTTTGCTAACCCTTTCCTCAAGAGGTTGCACTAAGCACTCCTCCTTCCACTAAGGGGTATCTCTTT[C/T]
CTTGCGGAGGCGAGATCCGGCCTTCACAAACTTCTCTCGGCCAACCACACGTAGATCGGTGGCTCGGGAGTGACACCTAGCCGTCTAGGAGTCCTCAACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.30% 27.30% 0.32% 0.00% NA
All Indica  2759 53.20% 46.40% 0.43% 0.00% NA
All Japonica  1512 99.70% 0.20% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 23.50% 76.30% 0.17% 0.00% NA
Indica II  465 74.00% 25.20% 0.86% 0.00% NA
Indica III  913 59.00% 41.00% 0.00% 0.00% NA
Indica Intermediate  786 56.60% 42.50% 0.89% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 87.80% 10.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410451065 G -> A LOC_Os04g18800.1 upstream_gene_variant ; 2933.0bp to feature; MODIFIER silent_mutation Average:38.322; most accessible tissue: Zhenshan97 flower, score: 58.632 N N N N
vg0410451065 G -> A LOC_Os04g18790.1 downstream_gene_variant ; 1200.0bp to feature; MODIFIER silent_mutation Average:38.322; most accessible tissue: Zhenshan97 flower, score: 58.632 N N N N
vg0410451065 G -> A LOC_Os04g18780-LOC_Os04g18790 intergenic_region ; MODIFIER silent_mutation Average:38.322; most accessible tissue: Zhenshan97 flower, score: 58.632 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410451065 NA 6.13E-09 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410451065 7.55E-06 1.31E-07 mr1304_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410451065 NA 8.98E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410451065 NA 3.43E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410451065 NA 7.29E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410451065 3.50E-06 NA mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410451065 NA 5.27E-11 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410451065 1.98E-09 3.94E-13 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410451065 5.44E-08 7.36E-21 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251