\
| Variant ID: vg0410451060 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10451060 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGGAGGTTGAGGACTCCTAGACGGCTAGGTGTCACTCCCGAGCCACCGATCTACGTGTGGTTGGCCGAGAGAAGTTTGTGAAGGCCGGATCTCGCCTCC[G/A]
CAAGGAAAGAGATACCCCTTAGTGGAAGGAGGAGTGCTTAGTGCAACCTCTTGAGGAAAGGGTTAGCAAAGACCCGGCTCTTAGTGAGCTCCTCAACGGA
TCCGTTGAGGAGCTCACTAAGAGCCGGGTCTTTGCTAACCCTTTCCTCAAGAGGTTGCACTAAGCACTCCTCCTTCCACTAAGGGGTATCTCTTTCCTTG[C/T]
GGAGGCGAGATCCGGCCTTCACAAACTTCTCTCGGCCAACCACACGTAGATCGGTGGCTCGGGAGTGACACCTAGCCGTCTAGGAGTCCTCAACCTCCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.50% | 14.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 62.20% | 37.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.00% | 28.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 15.60% | 84.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 24.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410451060 | G -> A | LOC_Os04g18800.1 | upstream_gene_variant ; 2938.0bp to feature; MODIFIER | silent_mutation | Average:38.514; most accessible tissue: Zhenshan97 flower, score: 58.632 | N | N | N | N |
| vg0410451060 | G -> A | LOC_Os04g18790.1 | downstream_gene_variant ; 1205.0bp to feature; MODIFIER | silent_mutation | Average:38.514; most accessible tissue: Zhenshan97 flower, score: 58.632 | N | N | N | N |
| vg0410451060 | G -> A | LOC_Os04g18780-LOC_Os04g18790 | intergenic_region ; MODIFIER | silent_mutation | Average:38.514; most accessible tissue: Zhenshan97 flower, score: 58.632 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410451060 | NA | 1.29E-06 | mr1319 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410451060 | NA | 9.04E-13 | mr1454 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410451060 | NA | 8.13E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410451060 | NA | 2.22E-07 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410451060 | NA | 3.30E-08 | mr1786 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |