\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410398025:

Variant ID: vg0410398025 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10398025
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.53, T: 0.47, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GCCGATGCATGATAGCCGATGTGTTCACATCGCCTTGAGATGGCCGATATTGTTCTATCGCCCTTAGTTGTTTTTCATATTGTAATCGGTTATGGTTTTC[T/C]
GATGTACGGCGGCCGATATTGTGATATCGCCCTTAGTTCAACTTATAATTTTAGCAATGTCTTCGTCATTGTAAAATTAGGGGGGCATATATGTGCAAAT

Reverse complement sequence

ATTTGCACATATATGCCCCCCTAATTTTACAATGACGAAGACATTGCTAAAATTATAAGTTGAACTAAGGGCGATATCACAATATCGGCCGCCGTACATC[A/G]
GAAAACCATAACCGATTACAATATGAAAAACAACTAAGGGCGATAGAACAATATCGGCCATCTCAAGGCGATGTGAACACATCGGCTATCATGCATCGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.80% 20.50% 0.17% 30.51% NA
All Indica  2759 52.50% 1.10% 0.29% 46.07% NA
All Japonica  1512 38.40% 60.80% 0.00% 0.73% NA
Aus  269 50.90% 0.00% 0.00% 49.07% NA
Indica I  595 77.60% 1.00% 0.00% 21.34% NA
Indica II  465 29.90% 1.90% 0.43% 67.74% NA
Indica III  913 49.20% 0.50% 0.33% 49.95% NA
Indica Intermediate  786 50.80% 1.40% 0.38% 47.46% NA
Temperate Japonica  767 3.90% 96.00% 0.00% 0.13% NA
Tropical Japonica  504 95.00% 4.00% 0.00% 0.99% NA
Japonica Intermediate  241 29.90% 68.00% 0.00% 2.07% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 48.90% 22.20% 0.00% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410398025 T -> C LOC_Os04g18730.1 downstream_gene_variant ; 1023.0bp to feature; MODIFIER silent_mutation Average:13.154; most accessible tissue: Callus, score: 39.879 N N N N
vg0410398025 T -> C LOC_Os04g18740.1 downstream_gene_variant ; 222.0bp to feature; MODIFIER silent_mutation Average:13.154; most accessible tissue: Callus, score: 39.879 N N N N
vg0410398025 T -> C LOC_Os04g18750.1 downstream_gene_variant ; 4343.0bp to feature; MODIFIER silent_mutation Average:13.154; most accessible tissue: Callus, score: 39.879 N N N N
vg0410398025 T -> C LOC_Os04g18730-LOC_Os04g18740 intergenic_region ; MODIFIER silent_mutation Average:13.154; most accessible tissue: Callus, score: 39.879 N N N N
vg0410398025 T -> DEL N N silent_mutation Average:13.154; most accessible tissue: Callus, score: 39.879 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410398025 NA 6.52E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 3.82E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 9.17E-19 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 2.17E-06 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 3.42E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 7.66E-07 NA mr1164 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 2.10E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 9.29E-08 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 4.91E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 3.89E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 5.73E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 3.88E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 3.88E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 7.60E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 6.72E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 3.67E-07 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 3.57E-07 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 7.32E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 9.97E-31 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 3.46E-13 mr1789 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 1.05E-13 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 6.15E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 2.12E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 2.31E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 2.79E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025 NA 8.21E-09 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251