Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410398025:

Variant ID: vg0410398025 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 10398025
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.53, T: 0.47, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

GCCGATGCATGATAGCCGATGTGTTCACATCGCCTTGAGATGGCCGATATTGTTCTATCGCCCTTAGTTGTTTTTCATATTGTAATCGGTTATGGTTTTC[T/C]
GATGTACGGCGGCCGATATTGTGATATCGCCCTTAGTTCAACTTATAATTTTAGCAATGTCTTCGTCATTGTAAAATTAGGGGGGCATATATGTGCAAAT

Reverse complement sequence

ATTTGCACATATATGCCCCCCTAATTTTACAATGACGAAGACATTGCTAAAATTATAAGTTGAACTAAGGGCGATATCACAATATCGGCCGCCGTACATC[A/G]
GAAAACCATAACCGATTACAATATGAAAAACAACTAAGGGCGATAGAACAATATCGGCCATCTCAAGGCGATGTGAACACATCGGCTATCATGCATCGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.80%	20.50%	0.17%	30.51%	NA
All Indica	2759	52.50%	1.10%	0.29%	46.07%	NA
All Japonica	1512	38.40%	60.80%	0.00%	0.73%	NA
Aus	269	50.90%	0.00%	0.00%	49.07%	NA
Indica I	595	77.60%	1.00%	0.00%	21.34%	NA
Indica II	465	29.90%	1.90%	0.43%	67.74%	NA
Indica III	913	49.20%	0.50%	0.33%	49.95%	NA
Indica Intermediate	786	50.80%	1.40%	0.38%	47.46%	NA
Temperate Japonica	767	3.90%	96.00%	0.00%	0.13%	NA
Tropical Japonica	504	95.00%	4.00%	0.00%	0.99%	NA
Japonica Intermediate	241	29.90%	68.00%	0.00%	2.07%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	48.90%	22.20%	0.00%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0410398025	T -> C	LOC_Os04g18730.1	downstream_gene_variant ; 1023.0bp to feature; MODIFIER	silent_mutation	Average:13.154; most accessible tissue: Callus, score: 39.879	N	N	N	N
vg0410398025	T -> C	LOC_Os04g18740.1	downstream_gene_variant ; 222.0bp to feature; MODIFIER	silent_mutation	Average:13.154; most accessible tissue: Callus, score: 39.879	N	N	N	N
vg0410398025	T -> C	LOC_Os04g18750.1	downstream_gene_variant ; 4343.0bp to feature; MODIFIER	silent_mutation	Average:13.154; most accessible tissue: Callus, score: 39.879	N	N	N	N
vg0410398025	T -> C	LOC_Os04g18730-LOC_Os04g18740	intergenic_region ; MODIFIER	silent_mutation	Average:13.154; most accessible tissue: Callus, score: 39.879	N	N	N	N
vg0410398025	T -> DEL	N	N	silent_mutation	Average:13.154; most accessible tissue: Callus, score: 39.879	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0410398025	NA	6.52E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	3.82E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	9.17E-19	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	2.17E-06	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	3.42E-06	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	7.66E-07	NA	mr1164	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	2.10E-10	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	9.29E-08	mr1194	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	4.91E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	3.89E-06	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	5.73E-07	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	3.88E-08	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	3.88E-11	mr1454	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	7.60E-06	mr1482	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	6.72E-12	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	3.67E-07	mr1715	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	3.57E-07	mr1739	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	7.32E-13	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	9.97E-31	mr1789	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	3.46E-13	mr1789	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	1.05E-13	mr1844	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	6.15E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	2.12E-09	mr1880	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	2.31E-14	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	2.79E-10	mr1282_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410398025	NA	8.21E-09	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251