\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0410397733:

Variant ID: vg0410397733 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 10397733
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.54, G: 0.46, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


ACTGAGGATAAGGAACGAGTTGCTCGACATTACAACAAGAAAGTGGTGCCCAAGTCCTTTTCGGAAGGAGAACTTGTATGGAAATTGATTTTGCCGATTG[A/G]
AACTCGGGATAACAAAATTGGCAAGTGGTCGCCCGAATTGGGAAGGACCATTTCAAATCTATAAGGTTGTGTCTAAGGGAGCTTACGTGTTGCAAGGACT

Reverse complement sequence

AGTCCTTGCAACACGTAAGCTCCCTTAGACACAACCTTATAGATTTGAAATGGTCCTTCCCAATTCGGGCGACCACTTGCCAATTTTGTTATCCCGAGTT[T/C]
CAATCGGCAAAATCAATTTCCATACAAGTTCTCCTTCCGAAAAGGACTTGGGCACCACTTTCTTGTTGTAATGTCGAGCAACTCGTTCCTTATCCTCAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.20% 20.70% 1.27% 28.90% NA
All Indica  2759 53.00% 1.20% 1.23% 44.51% NA
All Japonica  1512 38.40% 60.80% 0.00% 0.73% NA
Aus  269 52.80% 0.70% 9.29% 37.17% NA
Indica I  595 78.20% 1.20% 0.67% 20.00% NA
Indica II  465 30.50% 2.20% 1.08% 66.24% NA
Indica III  913 49.60% 0.40% 1.64% 48.30% NA
Indica Intermediate  786 51.30% 1.70% 1.27% 45.80% NA
Temperate Japonica  767 3.90% 96.00% 0.00% 0.13% NA
Tropical Japonica  504 95.00% 4.00% 0.00% 0.99% NA
Japonica Intermediate  241 29.90% 68.00% 0.00% 2.07% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 48.90% 22.20% 1.11% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0410397733 A -> DEL N N silent_mutation Average:12.31; most accessible tissue: Callus, score: 35.034 N N N N
vg0410397733 A -> G LOC_Os04g18730.1 downstream_gene_variant ; 731.0bp to feature; MODIFIER silent_mutation Average:12.31; most accessible tissue: Callus, score: 35.034 N N N N
vg0410397733 A -> G LOC_Os04g18740.1 downstream_gene_variant ; 514.0bp to feature; MODIFIER silent_mutation Average:12.31; most accessible tissue: Callus, score: 35.034 N N N N
vg0410397733 A -> G LOC_Os04g18750.1 downstream_gene_variant ; 4635.0bp to feature; MODIFIER silent_mutation Average:12.31; most accessible tissue: Callus, score: 35.034 N N N N
vg0410397733 A -> G LOC_Os04g18730-LOC_Os04g18740 intergenic_region ; MODIFIER silent_mutation Average:12.31; most accessible tissue: Callus, score: 35.034 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0410397733 NA 9.91E-09 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 3.82E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 2.17E-06 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 3.42E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 6.57E-11 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 9.29E-08 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 4.91E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 7.50E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 2.87E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 5.73E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 3.88E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 2.16E-06 NA mr1454 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 3.88E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 2.04E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 3.67E-07 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 7.53E-08 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 3.57E-07 mr1739 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 3.32E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 2.16E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 4.25E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 2.39E-33 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 3.46E-13 mr1789 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 2.01E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 9.61E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 5.49E-13 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 6.15E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 2.12E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 1.64E-15 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 3.01E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 5.20E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0410397733 NA 9.98E-14 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251