\
| Variant ID: vg0410390630 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 10390630 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, A: 0.31, others allele: 0.00, population size: 86. )
TCTAAGTGATTTATACTATCTCGGCATGGCGACCGATCTATCCCGATCACTTGATTTAAGTATATATCGACATAAGGATTATATATTGTTAATATCTACA[G/A]
CCGATCGAGTAGATTTAGTTCTTTCTTATATATTCATGATTGCCGATCGATCCACATATGACATCGGCTCCGAGATAAATGATACGTCATCGGCAATTAG
CTAATTGCCGATGACGTATCATTTATCTCGGAGCCGATGTCATATGTGGATCGATCGGCAATCATGAATATATAAGAAAGAACTAAATCTACTCGATCGG[C/T]
TGTAGATATTAACAATATATAATCCTTATGTCGATATATACTTAAATCAAGTGATCGGGATAGATCGGTCGCCATGCCGAGATAGTATAAATCACTTAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.50% | 18.50% | 5.37% | 9.61% | NA |
| All Indica | 2759 | 48.90% | 27.80% | 8.55% | 14.82% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.13% | 0.00% | NA |
| Aus | 269 | 50.20% | 30.90% | 4.09% | 14.87% | NA |
| Indica I | 595 | 22.90% | 42.40% | 18.49% | 16.30% | NA |
| Indica II | 465 | 72.00% | 16.60% | 4.73% | 6.67% | NA |
| Indica III | 913 | 51.50% | 23.70% | 6.02% | 18.84% | NA |
| Indica Intermediate | 786 | 51.80% | 28.10% | 6.23% | 13.87% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.40% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 82.30% | 10.40% | 3.12% | 4.17% | NA |
| Intermediate | 90 | 83.30% | 13.30% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0410390630 | G -> DEL | N | N | silent_mutation | Average:7.345; most accessible tissue: Callus, score: 20.701 | N | N | N | N |
| vg0410390630 | G -> A | LOC_Os04g18730.1 | intron_variant ; MODIFIER | silent_mutation | Average:7.345; most accessible tissue: Callus, score: 20.701 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0410390630 | NA | 8.96E-06 | mr1386 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410390630 | NA | 7.25E-06 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410390630 | NA | 1.58E-08 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410390630 | NA | 5.32E-06 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410390630 | NA | 1.14E-06 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410390630 | NA | 4.16E-07 | mr1654_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410390630 | NA | 4.12E-07 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410390630 | NA | 2.87E-14 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410390630 | NA | 2.16E-08 | mr1835_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0410390630 | NA | 4.38E-17 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |